Incidental Mutation 'R3707:Cyp2d10'
ID258767
Institutional Source Beutler Lab
Gene Symbol Cyp2d10
Ensembl Gene ENSMUSG00000094806
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 10
SynonymsCyp2d, P450-2D
MMRRC Submission 040700-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.389) question?
Stock #R3707 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82402846-82407195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82403016 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 469 (F469L)
Ref Sequence ENSEMBL: ENSMUSP00000072555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072776] [ENSMUST00000229628] [ENSMUST00000229911] [ENSMUST00000230198] [ENSMUST00000230248] [ENSMUST00000230843]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072776
AA Change: F469L

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000072555
Gene: ENSMUSG00000094806
AA Change: F469L

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Pfam:p450 37 497 6e-143 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183705
Predicted Effect probably benign
Transcript: ENSMUST00000229628
Predicted Effect probably benign
Transcript: ENSMUST00000229911
AA Change: F300L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect silent
Transcript: ENSMUST00000230198
Predicted Effect probably benign
Transcript: ENSMUST00000230248
Predicted Effect probably benign
Transcript: ENSMUST00000230843
Meta Mutation Damage Score 0.0698 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
2810474O19Rik C T 6: 149,329,113 S1219L probably damaging Het
Avpr1a T A 10: 122,449,109 F102Y probably damaging Het
Bcs1l A G 1: 74,590,105 probably benign Het
Chrng C T 1: 87,210,611 Q375* probably null Het
Dennd6a T C 14: 26,592,391 probably benign Het
Eef2k C A 7: 120,884,712 L224I probably damaging Het
Gm11545 T C 11: 94,757,559 noncoding transcript Het
Herpud1 T A 8: 94,392,239 V207D probably damaging Het
Hmbox1 T C 14: 64,896,836 Y105C probably benign Het
Ighv1-85 A T 12: 116,000,216 W55R probably damaging Het
Lgr4 T C 2: 109,970,754 L83P probably damaging Het
Lrch1 C T 14: 74,857,997 M134I probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mtg1 A T 7: 140,149,804 K269M probably damaging Het
Nkain3 A T 4: 20,484,920 F52L possibly damaging Het
Nr4a3 A T 4: 48,056,699 Y417F probably damaging Het
Olfr1145 T C 2: 87,810,176 C119R probably damaging Het
Olfr767 T A 10: 129,079,385 I193F probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Pdhb T C 14: 8,170,409 N114S probably damaging Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Pimreg G A 11: 72,046,332 probably benign Het
Ppfia4 T C 1: 134,309,660 E967G probably damaging Het
Rif1 T A 2: 52,093,580 D578E probably damaging Het
RP23-114B10.6 G C 8: 69,372,416 noncoding transcript Het
Rrbp1 G T 2: 143,953,277 A1269E probably benign Het
Rufy3 G A 5: 88,643,032 A531T probably benign Het
Slc22a22 C A 15: 57,250,973 L319F probably damaging Het
Tapbpl A G 6: 125,224,695 probably null Het
Tdrd1 T C 19: 56,865,993 S1124P possibly damaging Het
Top2a T C 11: 98,996,825 K1286E probably benign Het
Top2b T C 14: 16,388,447 V188A probably damaging Het
Vmn2r4 A T 3: 64,389,474 I630N probably damaging Het
Vmn2r53 T C 7: 12,582,054 T613A possibly damaging Het
Zbtb40 A G 4: 136,999,568 Y486H probably damaging Het
Zfp715 T C 7: 43,311,129 T13A probably benign Het
Zfx A G X: 94,098,807 V36A possibly damaging Het
Other mutations in Cyp2d10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Cyp2d10 APN 15 82403314 missense possibly damaging 0.71
IGL00840:Cyp2d10 APN 15 82404490 missense probably benign 0.40
IGL01293:Cyp2d10 APN 15 82403009 missense possibly damaging 0.92
IGL01339:Cyp2d10 APN 15 82403841 missense probably benign 0.33
IGL01871:Cyp2d10 APN 15 82403885 missense probably damaging 1.00
IGL02132:Cyp2d10 APN 15 82404607 intron probably benign
IGL02713:Cyp2d10 APN 15 82406082 unclassified probably benign
IGL02869:Cyp2d10 APN 15 82403868 missense possibly damaging 0.84
R0102:Cyp2d10 UTSW 15 82404593 missense probably benign 0.01
R0102:Cyp2d10 UTSW 15 82404593 missense probably benign 0.01
R0279:Cyp2d10 UTSW 15 82405339 missense possibly damaging 0.94
R0331:Cyp2d10 UTSW 15 82407026 missense probably benign 0.12
R1344:Cyp2d10 UTSW 15 82405905 critical splice donor site probably null
R1418:Cyp2d10 UTSW 15 82405905 critical splice donor site probably null
R1465:Cyp2d10 UTSW 15 82403928 intron probably null
R1465:Cyp2d10 UTSW 15 82403928 intron probably null
R1706:Cyp2d10 UTSW 15 82405582 missense probably damaging 0.96
R1712:Cyp2d10 UTSW 15 82403039 missense probably damaging 1.00
R1940:Cyp2d10 UTSW 15 82405294 missense probably benign 0.13
R1983:Cyp2d10 UTSW 15 82405999 missense probably benign 0.15
R2056:Cyp2d10 UTSW 15 82403814 missense probably damaging 1.00
R2058:Cyp2d10 UTSW 15 82403814 missense probably damaging 1.00
R3708:Cyp2d10 UTSW 15 82403016 missense possibly damaging 0.91
R4042:Cyp2d10 UTSW 15 82406068 missense probably benign 0.33
R4531:Cyp2d10 UTSW 15 82405261 missense probably benign 0.31
R4694:Cyp2d10 UTSW 15 82404483 missense probably damaging 1.00
R4869:Cyp2d10 UTSW 15 82403766 missense probably benign 0.00
R5071:Cyp2d10 UTSW 15 82403753 missense probably benign 0.07
R5072:Cyp2d10 UTSW 15 82403753 missense probably benign 0.07
R5073:Cyp2d10 UTSW 15 82403753 missense probably benign 0.07
R5074:Cyp2d10 UTSW 15 82403753 missense probably benign 0.07
R5746:Cyp2d10 UTSW 15 82405271 missense probably benign 0.38
R7096:Cyp2d10 UTSW 15 82405261 missense probably benign
R7212:Cyp2d10 UTSW 15 82404246 critical splice acceptor site probably null
R7324:Cyp2d10 UTSW 15 82403760 missense probably damaging 0.97
R7487:Cyp2d10 UTSW 15 82404592 missense probably benign 0.00
X0063:Cyp2d10 UTSW 15 82406000 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCTGAAGACCCAGCAAGAG -3'
(R):5'- ATGCCATTCTCAGCAGGTGC -3'

Sequencing Primer
(F):5'- CTGGGATTGAAGCAGAAAACAGC -3'
(R):5'- ATTCTCAGCAGGTGCCTGGG -3'
Posted On2015-01-23