Incidental Mutation 'R3707:Zfx'
ID258769
Institutional Source Beutler Lab
Gene Symbol Zfx
Ensembl Gene ENSMUSG00000079509
Gene Namezinc finger protein X-linked
SynonymsZfx5, Zfx6, Zfx5,6
MMRRC Submission 040700-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R3707 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location94074631-94123702 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94098807 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 36 (V36A)
Ref Sequence ENSEMBL: ENSMUSP00000109558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088102] [ENSMUST00000113925] [ENSMUST00000113926] [ENSMUST00000113927] [ENSMUST00000137853]
Predicted Effect probably benign
Transcript: ENSMUST00000088102
AA Change: V36A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000085423
Gene: ENSMUSG00000079509
AA Change: V36A

DomainStartEndE-ValueType
Pfam:Zfx_Zfy_act 71 404 9.2e-153 PFAM
ZnF_C2H2 419 441 2.65e-5 SMART
ZnF_C2H2 450 472 1.45e-2 SMART
ZnF_C2H2 482 504 7.26e-3 SMART
ZnF_C2H2 513 536 3.11e-2 SMART
ZnF_C2H2 542 564 3.69e-4 SMART
ZnF_C2H2 570 593 4.79e-3 SMART
ZnF_C2H2 599 621 2.02e-1 SMART
ZnF_C2H2 627 650 1.53e-1 SMART
ZnF_C2H2 656 678 2.57e-3 SMART
ZnF_C2H2 684 707 3.52e-1 SMART
ZnF_C2H2 713 735 1.12e-3 SMART
ZnF_C2H2 741 764 1.28e-3 SMART
ZnF_C2H2 770 792 2.91e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113925
AA Change: V36A

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109558
Gene: ENSMUSG00000079509
AA Change: V36A

DomainStartEndE-ValueType
Pfam:Zfx_Zfy_act 70 217 1.1e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113926
AA Change: V36A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000109559
Gene: ENSMUSG00000079509
AA Change: V36A

DomainStartEndE-ValueType
Pfam:Zfx_Zfy_act 70 404 4.3e-169 PFAM
ZnF_C2H2 419 441 2.65e-5 SMART
ZnF_C2H2 450 472 1.45e-2 SMART
ZnF_C2H2 482 504 7.26e-3 SMART
ZnF_C2H2 513 536 3.11e-2 SMART
ZnF_C2H2 542 564 3.69e-4 SMART
ZnF_C2H2 570 593 4.79e-3 SMART
ZnF_C2H2 599 621 2.02e-1 SMART
ZnF_C2H2 627 650 1.53e-1 SMART
ZnF_C2H2 656 678 2.57e-3 SMART
ZnF_C2H2 684 707 3.52e-1 SMART
ZnF_C2H2 713 735 1.12e-3 SMART
ZnF_C2H2 741 764 1.28e-3 SMART
ZnF_C2H2 770 792 2.91e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113927
AA Change: V36A

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000109560
Gene: ENSMUSG00000079509
AA Change: V36A

DomainStartEndE-ValueType
Pfam:Zfx_Zfy_act 70 404 4.3e-169 PFAM
ZnF_C2H2 419 441 2.65e-5 SMART
ZnF_C2H2 450 472 1.45e-2 SMART
ZnF_C2H2 482 504 7.26e-3 SMART
ZnF_C2H2 513 536 3.11e-2 SMART
ZnF_C2H2 542 564 3.69e-4 SMART
ZnF_C2H2 570 593 4.79e-3 SMART
ZnF_C2H2 599 621 2.02e-1 SMART
ZnF_C2H2 627 650 1.53e-1 SMART
ZnF_C2H2 656 678 2.57e-3 SMART
ZnF_C2H2 684 707 3.52e-1 SMART
ZnF_C2H2 713 735 1.12e-3 SMART
ZnF_C2H2 741 764 1.28e-3 SMART
ZnF_C2H2 770 792 2.91e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135661
Predicted Effect possibly damaging
Transcript: ENSMUST00000137853
AA Change: V36A

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118903
Gene: ENSMUSG00000079509
AA Change: V36A

DomainStartEndE-ValueType
Pfam:Zfx_Zfy_act 70 216 5.4e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139695
Meta Mutation Damage Score 0.2146 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene on the X chromosome is structurally similar to a related gene on the Y chromosome. It encodes a member of the krueppel C2H2-type zinc-finger protein family. The full-length protein contains an acidic transcriptional activation domain (AD), a nuclear localization sequence (NLS) and a DNA binding domain (DBD) consisting of 13 C2H2-type zinc fingers. Studies in mouse embryonic and adult hematopoietic stem cells showed that this gene was required as a transcriptional regulator for self-renewal of both stem cell types, but it was dispensable for growth and differentiation of their progeny. Multiple alternatively spliced transcript variants encoding different isoforms have been identified, but the full-length nature of some variants has not been determined. [provided by RefSeq, May 2010]
PHENOTYPE: Male mice hemizygous or female mice homozygous for one knock-out allele exhibit reduced size, viability, and gametes. Another knock-out allele generates mice that exhibit embryonic lethality associated with abnormal extraembryonic tissue and reduction in hematopoietic stem cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik G T 11: 109,794,154 C172* probably null Het
2410089E03Rik T C 15: 8,259,816 S2917P unknown Het
2810474O19Rik C T 6: 149,329,113 S1219L probably damaging Het
Avpr1a T A 10: 122,449,109 F102Y probably damaging Het
Bcs1l A G 1: 74,590,105 probably benign Het
Chrng C T 1: 87,210,611 Q375* probably null Het
Cyp2d10 A G 15: 82,403,016 F469L possibly damaging Het
Dennd6a T C 14: 26,592,391 probably benign Het
Eef2k C A 7: 120,884,712 L224I probably damaging Het
Gm11545 T C 11: 94,757,559 noncoding transcript Het
Herpud1 T A 8: 94,392,239 V207D probably damaging Het
Hmbox1 T C 14: 64,896,836 Y105C probably benign Het
Ighv1-85 A T 12: 116,000,216 W55R probably damaging Het
Lgr4 T C 2: 109,970,754 L83P probably damaging Het
Lrch1 C T 14: 74,857,997 M134I probably damaging Het
Macrod2 C A 2: 141,810,629 T204K probably damaging Het
Mtg1 A T 7: 140,149,804 K269M probably damaging Het
Nkain3 A T 4: 20,484,920 F52L possibly damaging Het
Nr4a3 A T 4: 48,056,699 Y417F probably damaging Het
Olfr1145 T C 2: 87,810,176 C119R probably damaging Het
Olfr767 T A 10: 129,079,385 I193F probably benign Het
Pappa2 A T 1: 158,834,918 Y1162* probably null Het
Pdhb T C 14: 8,170,409 N114S probably damaging Het
Pigc T A 1: 161,971,094 M215K probably benign Het
Pimreg G A 11: 72,046,332 probably benign Het
Ppfia4 T C 1: 134,309,660 E967G probably damaging Het
Rif1 T A 2: 52,093,580 D578E probably damaging Het
RP23-114B10.6 G C 8: 69,372,416 noncoding transcript Het
Rrbp1 G T 2: 143,953,277 A1269E probably benign Het
Rufy3 G A 5: 88,643,032 A531T probably benign Het
Slc22a22 C A 15: 57,250,973 L319F probably damaging Het
Tapbpl A G 6: 125,224,695 probably null Het
Tdrd1 T C 19: 56,865,993 S1124P possibly damaging Het
Top2a T C 11: 98,996,825 K1286E probably benign Het
Top2b T C 14: 16,388,447 V188A probably damaging Het
Vmn2r4 A T 3: 64,389,474 I630N probably damaging Het
Vmn2r53 T C 7: 12,582,054 T613A possibly damaging Het
Zbtb40 A G 4: 136,999,568 Y486H probably damaging Het
Zfp715 T C 7: 43,311,129 T13A probably benign Het
Other mutations in Zfx
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3706:Zfx UTSW X 94098807 missense possibly damaging 0.86
R4133:Zfx UTSW X 94080858 missense probably damaging 0.99
Z1088:Zfx UTSW X 94079443 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGATGATGACTGTTTCCG -3'
(R):5'- CTACTTTTGGGGAGAAGTTGAAC -3'

Sequencing Primer
(F):5'- GGATGATGACTGTTTCCGATACATC -3'
(R):5'- GGCATGAGCTTTTGAAACCC -3'
Posted On2015-01-23