Incidental Mutation 'R3718:Il18r1'
ID258770
Institutional Source Beutler Lab
Gene Symbol Il18r1
Ensembl Gene ENSMUSG00000026070
Gene Nameinterleukin 18 receptor 1
SynonymsIl18ralpha, Il1rrp
MMRRC Submission 040710-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3718 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location40465552-40500854 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40495788 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 381 (E381G)
Ref Sequence ENSEMBL: ENSMUSP00000142070 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087983] [ENSMUST00000108044] [ENSMUST00000167723] [ENSMUST00000193391] [ENSMUST00000193793] [ENSMUST00000195684]
Predicted Effect probably benign
Transcript: ENSMUST00000087983
AA Change: E381G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000085298
Gene: ENSMUSG00000026070
AA Change: E381G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108044
AA Change: E381G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000103679
Gene: ENSMUSG00000026070
AA Change: E381G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167723
SMART Domains Protein: ENSMUSP00000128277
Gene: ENSMUSG00000026070

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193391
SMART Domains Protein: ENSMUSP00000141695
Gene: ENSMUSG00000026070

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193793
SMART Domains Protein: ENSMUSP00000141464
Gene: ENSMUSG00000026070

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 3.7e-3 SMART
IG_like 132 189 9.7e-3 SMART
Pfam:Ig_2 214 263 5.2e-1 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195684
AA Change: E381G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142070
Gene: ENSMUSG00000026070
AA Change: E381G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 25 113 8.93e-1 SMART
IG_like 126 204 7.06e0 SMART
IG 219 315 3.63e0 SMART
transmembrane domain 326 348 N/A INTRINSIC
TIR 371 519 3.8e-37 SMART
Meta Mutation Damage Score 0.1017 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This receptor specifically binds interleukin 18 (IL18), and is essential for IL18 mediated signal transduction. IFN-alpha and IL12 are reported to induce the expression of this receptor in NK and T cells. This gene along with four other members of the interleukin 1 receptor family, including IL1R2, IL1R1, ILRL2 (IL-1Rrp2), and IL1RL1 (T1/ST2), form a gene cluster on chromosome 2q. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene exhibit impaire Th1 cell development and defective NK cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T C 15: 41,866,293 D237G probably benign Het
Alas2 T C X: 150,560,730 probably benign Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Aspm T C 1: 139,480,889 Y2505H probably benign Het
Aspm G A 1: 139,490,427 V2965I probably benign Het
Ccna2 A T 3: 36,566,238 V285E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Dpp3 A G 19: 4,923,065 probably null Het
Gng11 G A 6: 4,008,078 R47H probably benign Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il9 G A 13: 56,479,451 T116I probably damaging Het
Kcnh1 A G 1: 192,238,799 T129A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Ntsr1 T C 2: 180,542,706 F401L probably benign Het
Nup210 A T 6: 91,020,180 D1626E probably benign Het
Olfr1277 A G 2: 111,270,226 V47A probably benign Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Olfr943 A G 9: 39,185,065 R293G probably damaging Het
Pign A G 1: 105,649,281 probably null Het
Rad54l2 A G 9: 106,693,527 V1198A probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Slc40a1 G T 1: 45,910,991 H434N probably benign Het
Trdv2-1 T C 14: 53,946,538 Y76H probably benign Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Zc3hav1l G T 6: 38,295,125 S236R probably damaging Het
Other mutations in Il18r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Il18r1 APN 1 40498652 missense possibly damaging 0.68
IGL00742:Il18r1 APN 1 40480991 missense probably benign 0.11
IGL01448:Il18r1 APN 1 40474730 missense probably damaging 1.00
IGL01726:Il18r1 APN 1 40498403 missense possibly damaging 0.83
IGL02081:Il18r1 APN 1 40498505 missense probably damaging 1.00
IGL02425:Il18r1 APN 1 40491221 splice site probably benign
IGL02447:Il18r1 APN 1 40498337 critical splice acceptor site probably null
IGL02529:Il18r1 APN 1 40487059 missense possibly damaging 0.77
IGL02863:Il18r1 APN 1 40487007 missense probably damaging 1.00
IGL02928:Il18r1 APN 1 40478551 critical splice donor site probably null
IGL02941:Il18r1 APN 1 40498551 missense probably damaging 0.99
IGL03156:Il18r1 APN 1 40498368 missense possibly damaging 0.92
R0532:Il18r1 UTSW 1 40474901 missense probably damaging 0.97
R0926:Il18r1 UTSW 1 40487028 missense probably damaging 1.00
R1909:Il18r1 UTSW 1 40474914 missense probably damaging 1.00
R2212:Il18r1 UTSW 1 40491067 missense probably damaging 1.00
R2254:Il18r1 UTSW 1 40491220 missense possibly damaging 0.91
R2860:Il18r1 UTSW 1 40498557 missense possibly damaging 0.49
R2861:Il18r1 UTSW 1 40498557 missense possibly damaging 0.49
R2862:Il18r1 UTSW 1 40498557 missense possibly damaging 0.49
R3412:Il18r1 UTSW 1 40491067 missense probably damaging 1.00
R3432:Il18r1 UTSW 1 40487089 missense probably damaging 0.99
R3816:Il18r1 UTSW 1 40486972 splice site probably benign
R3894:Il18r1 UTSW 1 40474874 missense possibly damaging 0.79
R4061:Il18r1 UTSW 1 40474936 missense probably benign 0.33
R4062:Il18r1 UTSW 1 40474936 missense probably benign 0.33
R4381:Il18r1 UTSW 1 40471790 missense probably benign 0.00
R4972:Il18r1 UTSW 1 40491064 missense probably benign 0.39
R5059:Il18r1 UTSW 1 40481067 critical splice donor site probably null
R6229:Il18r1 UTSW 1 40474763 missense probably benign 0.02
R6458:Il18r1 UTSW 1 40491182 nonsense probably null
R6505:Il18r1 UTSW 1 40489707 missense probably benign
R6738:Il18r1 UTSW 1 40498656 missense probably benign 0.06
R7002:Il18r1 UTSW 1 40474853 missense probably benign 0.39
R7317:Il18r1 UTSW 1 40474832 missense possibly damaging 0.80
R7485:Il18r1 UTSW 1 40480980 missense probably benign 0.01
R7510:Il18r1 UTSW 1 40474875 missense probably benign 0.03
R7515:Il18r1 UTSW 1 40498670 missense not run
R7526:Il18r1 UTSW 1 40471772 missense probably damaging 0.99
R7793:Il18r1 UTSW 1 40471764 missense probably benign 0.01
R7870:Il18r1 UTSW 1 40491136 missense probably benign 0.45
R7953:Il18r1 UTSW 1 40491136 missense probably benign 0.45
R8004:Il18r1 UTSW 1 40474757 missense probably damaging 1.00
R8063:Il18r1 UTSW 1 40487038 missense probably benign 0.10
X0023:Il18r1 UTSW 1 40471761 missense probably benign 0.04
X0064:Il18r1 UTSW 1 40495713 intron probably null
Z1088:Il18r1 UTSW 1 40474751 missense probably damaging 1.00
Z1088:Il18r1 UTSW 1 40478486 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCATGGTGGAAGTCTTAAAGCAG -3'
(R):5'- AGGTGAAAAGATAAGCATCCATCTC -3'

Sequencing Primer
(F):5'- AGCAGAGGATTTTAAAAGATCTTGG -3'
(R):5'- GCATCCATCTCCCTAAAAGAATTATC -3'
Posted On2015-01-23