Incidental Mutation 'R3718:Pign'
ID258772
Institutional Source Beutler Lab
Gene Symbol Pign
Ensembl Gene ENSMUSG00000056536
Gene Namephosphatidylinositol glycan anchor biosynthesis, class N
Synonyms
MMRRC Submission 040710-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.799) question?
Stock #R3718 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location105518422-105663677 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 105649281 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070699] [ENSMUST00000070699] [ENSMUST00000186485] [ENSMUST00000186485] [ENSMUST00000187537] [ENSMUST00000187537] [ENSMUST00000190811] [ENSMUST00000190811]
Predicted Effect probably null
Transcript: ENSMUST00000070699
SMART Domains Protein: ENSMUSP00000069969
Gene: ENSMUSG00000056536

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Phosphodiest 116 303 1.2e-10 PFAM
Pfam:Sulfatase 148 334 2.1e-8 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 884 2.3e-138 PFAM
transmembrane domain 893 915 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000070699
SMART Domains Protein: ENSMUSP00000069969
Gene: ENSMUSG00000056536

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Phosphodiest 116 303 1.2e-10 PFAM
Pfam:Sulfatase 148 334 2.1e-8 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 884 2.3e-138 PFAM
transmembrane domain 893 915 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185983
Predicted Effect probably null
Transcript: ENSMUST00000186485
SMART Domains Protein: ENSMUSP00000139638
Gene: ENSMUSG00000056536

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Phosphodiest 109 330 3.7e-11 PFAM
Pfam:Sulfatase 148 334 2.1e-8 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 884 1.5e-141 PFAM
transmembrane domain 893 915 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000186485
SMART Domains Protein: ENSMUSP00000139638
Gene: ENSMUSG00000056536

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Phosphodiest 109 330 3.7e-11 PFAM
Pfam:Sulfatase 148 334 2.1e-8 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 884 1.5e-141 PFAM
transmembrane domain 893 915 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187537
SMART Domains Protein: ENSMUSP00000140020
Gene: ENSMUSG00000056536

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Phosphodiest 46 331 1.2e-12 PFAM
Pfam:Sulfatase 146 334 2.9e-6 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 800 5.9e-86 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000187537
SMART Domains Protein: ENSMUSP00000140020
Gene: ENSMUSG00000056536

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Phosphodiest 46 331 1.2e-12 PFAM
Pfam:Sulfatase 146 334 2.9e-6 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 800 5.9e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188858
Predicted Effect probably null
Transcript: ENSMUST00000190811
SMART Domains Protein: ENSMUSP00000140844
Gene: ENSMUSG00000056536

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Phosphodiest 46 331 1.1e-12 PFAM
Pfam:Sulfatase 146 334 2.8e-6 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 794 4.4e-86 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000190811
SMART Domains Protein: ENSMUSP00000140844
Gene: ENSMUSG00000056536

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:Phosphodiest 46 331 1.1e-12 PFAM
Pfam:Sulfatase 146 334 2.8e-6 PFAM
low complexity region 382 393 N/A INTRINSIC
Pfam:PigN 430 794 4.4e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191408
Meta Mutation Damage Score 0.9498 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is expressed in the endoplasmic reticulum and transfers phosphoethanolamine (EtNP) to the first mannose of the GPI anchor. Two alternatively spliced variants, which encode an identical isoform, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit abnormal gastrulation, forebrain hypoplasia, coloboma, and microphthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T C 15: 41,866,293 D237G probably benign Het
Alas2 T C X: 150,560,730 probably benign Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Aspm T C 1: 139,480,889 Y2505H probably benign Het
Aspm G A 1: 139,490,427 V2965I probably benign Het
Ccna2 A T 3: 36,566,238 V285E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Dpp3 A G 19: 4,923,065 probably null Het
Gng11 G A 6: 4,008,078 R47H probably benign Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il18r1 A G 1: 40,495,788 E381G probably benign Het
Il9 G A 13: 56,479,451 T116I probably damaging Het
Kcnh1 A G 1: 192,238,799 T129A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Ntsr1 T C 2: 180,542,706 F401L probably benign Het
Nup210 A T 6: 91,020,180 D1626E probably benign Het
Olfr1277 A G 2: 111,270,226 V47A probably benign Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Olfr943 A G 9: 39,185,065 R293G probably damaging Het
Rad54l2 A G 9: 106,693,527 V1198A probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Slc40a1 G T 1: 45,910,991 H434N probably benign Het
Trdv2-1 T C 14: 53,946,538 Y76H probably benign Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Zc3hav1l G T 6: 38,295,125 S236R probably damaging Het
Other mutations in Pign
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Pign APN 1 105597723 nonsense probably null
IGL00770:Pign APN 1 105597756 missense probably benign 0.00
IGL00774:Pign APN 1 105597756 missense probably benign 0.00
IGL00828:Pign APN 1 105554120 missense probably damaging 0.97
IGL01407:Pign APN 1 105589302 missense probably benign 0.06
IGL01523:Pign APN 1 105653178 missense probably damaging 0.98
IGL01953:Pign APN 1 105589039 splice site probably benign
IGL02389:Pign APN 1 105646781 nonsense probably null
PIT4810001:Pign UTSW 1 105597762 missense possibly damaging 0.83
R0080:Pign UTSW 1 105552405 missense probably damaging 1.00
R0097:Pign UTSW 1 105587976 splice site probably benign
R0302:Pign UTSW 1 105589093 missense possibly damaging 0.83
R0573:Pign UTSW 1 105653177 missense probably damaging 1.00
R0580:Pign UTSW 1 105591694 missense probably benign 0.03
R0946:Pign UTSW 1 105591697 missense probably benign 0.00
R1397:Pign UTSW 1 105657771 missense probably damaging 1.00
R1462:Pign UTSW 1 105585002 missense possibly damaging 0.95
R1462:Pign UTSW 1 105585002 missense possibly damaging 0.95
R1751:Pign UTSW 1 105653192 missense probably benign 0.19
R1753:Pign UTSW 1 105589317 missense possibly damaging 0.65
R1767:Pign UTSW 1 105653192 missense probably benign 0.19
R1854:Pign UTSW 1 105554498 missense probably damaging 0.99
R1907:Pign UTSW 1 105638215 missense possibly damaging 0.50
R2845:Pign UTSW 1 105657796 missense possibly damaging 0.80
R2846:Pign UTSW 1 105657796 missense possibly damaging 0.80
R3970:Pign UTSW 1 105656003 missense probably damaging 1.00
R4067:Pign UTSW 1 105587978 critical splice donor site probably null
R4110:Pign UTSW 1 105553815 unclassified probably benign
R4387:Pign UTSW 1 105522060 missense possibly damaging 0.48
R4393:Pign UTSW 1 105522026 missense probably benign 0.00
R4472:Pign UTSW 1 105648220 missense probably benign 0.29
R4519:Pign UTSW 1 105597666 critical splice donor site probably null
R4619:Pign UTSW 1 105521990 utr 3 prime probably benign
R4746:Pign UTSW 1 105585024 missense probably benign 0.33
R4859:Pign UTSW 1 105648167 nonsense probably null
R4893:Pign UTSW 1 105646711 missense probably damaging 1.00
R4953:Pign UTSW 1 105644502 missense probably benign 0.32
R5046:Pign UTSW 1 105522073 missense possibly damaging 0.94
R5377:Pign UTSW 1 105657812 missense probably benign 0.12
R5388:Pign UTSW 1 105655970 missense probably damaging 1.00
R5482:Pign UTSW 1 105546710 missense probably benign 0.44
R5594:Pign UTSW 1 105646869 intron probably benign
R5639:Pign UTSW 1 105589315 missense probably benign 0.09
R5778:Pign UTSW 1 105591722 missense probably damaging 1.00
R5821:Pign UTSW 1 105589063 missense possibly damaging 0.95
R5928:Pign UTSW 1 105558067 missense possibly damaging 0.55
R5979:Pign UTSW 1 105589274 missense probably benign 0.01
R6213:Pign UTSW 1 105589266 missense possibly damaging 0.50
R6292:Pign UTSW 1 105585077 missense possibly damaging 0.69
R6343:Pign UTSW 1 105585095 missense probably benign 0.33
R6566:Pign UTSW 1 105638181 critical splice donor site probably null
R6856:Pign UTSW 1 105553895 nonsense probably null
R6954:Pign UTSW 1 105553897 missense probably benign 0.39
R7361:Pign UTSW 1 105585053 missense probably benign 0.01
R7582:Pign UTSW 1 105649367 missense probably benign 0.00
R7622:Pign UTSW 1 105648117 missense possibly damaging 0.65
R7742:Pign UTSW 1 105552397 missense probably benign
R7892:Pign UTSW 1 105657676 missense probably benign 0.01
R7975:Pign UTSW 1 105657676 missense probably benign 0.01
X0025:Pign UTSW 1 105657634 missense probably benign 0.03
Z1177:Pign UTSW 1 105657820 start codon destroyed probably null 0.98
Predicted Primers PCR Primer
(F):5'- GTGCAGCATAGCCAAAGCAC -3'
(R):5'- CCACTACTGTTTAACAATTGCCAC -3'

Sequencing Primer
(F):5'- GCCAAAGCACAGATCATTTTAAACAG -3'
(R):5'- TAATGGGATGCAATGCCCTC -3'
Posted On2015-01-23