Mutagenetix > Incidental Mutations

Incidental Mutation 'R3718:Kcnh1'

258776

Institutional Source

Beutler Lab

Gene Symbol

Kcnh1

Ensembl Gene

ENSMUSG00000058248

Gene Name

potassium voltage-gated channel, subfamily H (eag-related), member 1

Synonyms

Kv10.1, Eag1, ether a go-go

MMRRC Submission

040710-MU

Accession Numbers

Genbank: NM_010600, NM_001038607; MGI: 1341721

Is this an essential gene?

Probably non essential (E-score: 0.131) question?

Stock #

R3718 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

192190774-192510159 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 192238799 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 129 (T129A)

Ref Sequence

ENSEMBL: ENSMUSP00000106468 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078470] [ENSMUST00000110844]

Predicted Effect

probably damaging
Transcript: ENSMUST00000078470
AA Change: T129A

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000077563
Gene: ENSMUSG00000058248
AA Change: T129A

Domain	Start	End	E-Value	Type
PAS	16	92	2.65e0	SMART
PAC	94	136	3.67e-9	SMART
Pfam:Ion_trans	217	510	2.2e-40	PFAM
Pfam:Ion_trans_2	422	504	7e-14	PFAM
cNMP	581	699	2.2e-21	SMART
low complexity region	714	726	N/A	INTRINSIC
coiled coil region	928	958	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110844
AA Change: T129A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106468
Gene: ENSMUSG00000058248
AA Change: T129A

Domain	Start	End	E-Value	Type
PAS	16	92	2.65e0	SMART
PAC	94	136	3.67e-9	SMART
transmembrane domain	219	241	N/A	INTRINSIC
Pfam:Ion_trans	252	471	3.4e-27	PFAM
Pfam:Ion_trans_2	395	477	3.7e-14	PFAM
cNMP	554	672	2.2e-21	SMART
low complexity region	687	699	N/A	INTRINSIC
coiled coil region	901	931	N/A	INTRINSIC

Meta Mutation Damage Score

0.3864

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.4%

Validation Efficiency

97% (36/37)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit of a voltage-gated non-inactivating delayed rectifier potassium channel. It is activated at the onset of myoblast differentiation. The gene is highly expressed in brain and in myoblasts. Overexpression of the gene may confer a growth advantage to cancer cells and favor tumor cell proliferation. Alternative splicing of this gene results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit a decreased depressive-like response during tail suspension testing. Mice homozygous for a different knock-out allele exhibit longer latency to move in haloperidol-treated mice and mild hyperactivity. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abra	T	C	15: 41,866,293	D237G	probably benign	Het
Alas2	T	C	X: 150,560,730		probably benign	Het
Ano6	A	G	15: 95,913,379	D120G	probably damaging	Het
Aspm	T	C	1: 139,480,889	Y2505H	probably benign	Het
Aspm	G	A	1: 139,490,427	V2965I	probably benign	Het
Ccna2	A	T	3: 36,566,238	V285E	probably benign	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dnajc10	A	G	2: 80,324,745		probably benign	Het
Dpp3	A	G	19: 4,923,065		probably null	Het
Gng11	G	A	6: 4,008,078	R47H	probably benign	Het
Hivep1	C	T	13: 42,158,495	H1404Y	probably damaging	Het
Il18r1	A	G	1: 40,495,788	E381G	probably benign	Het
Il9	G	A	13: 56,479,451	T116I	probably damaging	Het
Mroh7	T	C	4: 106,704,210	E612G	probably benign	Het
Nav1	A	T	1: 135,450,630	I1653K	probably damaging	Het
Neb	T	C	2: 52,277,470	E1948G	probably damaging	Het
Ntsr1	T	C	2: 180,542,706	F401L	probably benign	Het
Nup210	A	T	6: 91,020,180	D1626E	probably benign	Het
Olfr1277	A	G	2: 111,270,226	V47A	probably benign	Het
Olfr1495	A	G	19: 13,769,064	R241G	probably damaging	Het
Olfr943	A	G	9: 39,185,065	R293G	probably damaging	Het
Pign	A	G	1: 105,649,281		probably null	Het
Rad54l2	A	G	9: 106,693,527	V1198A	probably benign	Het
Sh3tc2	T	C	18: 61,990,343	V725A	probably benign	Het
Skint10	A	T	4: 112,746,739	W84R	probably damaging	Het
Slc40a1	G	T	1: 45,910,991	H434N	probably benign	Het
Trdv2-1	T	C	14: 53,946,538	Y76H	probably benign	Het
Trim43c	T	C	9: 88,844,977	S286P	probably benign	Het
Ttn	G	A	2: 76,745,214	P25112S	probably damaging	Het
Ubac1	C	T	2: 26,014,941	R95H	probably damaging	Het
Vps13d	A	G	4: 145,075,726	I405T	probably damaging	Het
Zc3hav1l	G	T	6: 38,295,125	S236R	probably damaging	Het

Other mutations in Kcnh1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00424:Kcnh1	APN	1	192418882	missense	probably damaging	0.99
IGL01675:Kcnh1	APN	1	192337593	missense	probably benign	0.09
IGL01726:Kcnh1	APN	1	192505856	missense	possibly damaging	0.47
IGL02006:Kcnh1	APN	1	192191015	missense	possibly damaging	0.75
IGL02428:Kcnh1	APN	1	192337543	nonsense	probably null
IGL02447:Kcnh1	APN	1	192224916	missense	possibly damaging	0.61
IGL02512:Kcnh1	APN	1	192505381	missense	possibly damaging	0.64
IGL02748:Kcnh1	APN	1	192221420	missense	probably damaging	1.00
IGL02879:Kcnh1	APN	1	192276915	missense	probably damaging	1.00
IGL02926:Kcnh1	APN	1	192276900	missense	probably damaging	1.00
IGL03058:Kcnh1	APN	1	192434891	missense	probably damaging	1.00
IGL03078:Kcnh1	APN	1	192434800	missense	probably damaging	1.00
IGL03148:Kcnh1	APN	1	192276999	missense	probably damaging	0.99
3-1:Kcnh1	UTSW	1	192337687	nonsense	probably null
PIT4449001:Kcnh1	UTSW	1	192418684	missense	probably damaging	1.00
R0226:Kcnh1	UTSW	1	192276804	nonsense	probably null
R0226:Kcnh1	UTSW	1	192276805	missense	probably damaging	1.00
R0240:Kcnh1	UTSW	1	192505340	missense	probably benign
R0240:Kcnh1	UTSW	1	192505340	missense	probably benign
R0422:Kcnh1	UTSW	1	192337580	missense	probably benign
R0510:Kcnh1	UTSW	1	192418941	splice site	probably benign
R0612:Kcnh1	UTSW	1	192277053	missense	probably damaging	1.00
R0667:Kcnh1	UTSW	1	192506038	missense	probably benign	0.00
R0838:Kcnh1	UTSW	1	192413206	missense	probably damaging	0.99
R1303:Kcnh1	UTSW	1	192276702	missense	probably damaging	1.00
R1389:Kcnh1	UTSW	1	192505763	missense	probably benign	0.00
R1826:Kcnh1	UTSW	1	192413068	missense	possibly damaging	0.64
R1997:Kcnh1	UTSW	1	192276935	missense	probably damaging	0.99
R2254:Kcnh1	UTSW	1	192505414	intron	probably null
R2274:Kcnh1	UTSW	1	192337521	missense	probably damaging	1.00
R2275:Kcnh1	UTSW	1	192337521	missense	probably damaging	1.00
R3029:Kcnh1	UTSW	1	192506060	missense	probably benign	0.00
R3427:Kcnh1	UTSW	1	192241930	missense	probably benign	0.06
R3552:Kcnh1	UTSW	1	192238766	missense	probably damaging	1.00
R3760:Kcnh1	UTSW	1	192506024	missense	probably damaging	1.00
R4009:Kcnh1	UTSW	1	192277140	missense	probably benign
R4027:Kcnh1	UTSW	1	192276699	missense	probably benign	0.05
R4453:Kcnh1	UTSW	1	192505517	missense	probably damaging	0.97
R4717:Kcnh1	UTSW	1	192276717	missense	probably damaging	0.99
R5014:Kcnh1	UTSW	1	192277080	missense	probably damaging	0.99
R5040:Kcnh1	UTSW	1	192505475	missense	probably benign	0.00
R5110:Kcnh1	UTSW	1	192337747	missense	possibly damaging	0.95
R5190:Kcnh1	UTSW	1	192505528	missense	probably benign	0.00
R5244:Kcnh1	UTSW	1	192224876	missense	probably benign	0.23
R5383:Kcnh1	UTSW	1	192505691	missense	probably benign	0.03
R5926:Kcnh1	UTSW	1	192413077	missense	probably benign	0.01
R6182:Kcnh1	UTSW	1	192191053	missense	probably damaging	0.97
R6516:Kcnh1	UTSW	1	192418781	missense	possibly damaging	0.50
R6567:Kcnh1	UTSW	1	192277104	missense	probably benign
R6655:Kcnh1	UTSW	1	192413083	missense	possibly damaging	0.89
R6715:Kcnh1	UTSW	1	192337641	missense	probably benign	0.00
R6823:Kcnh1	UTSW	1	192505289	makesense	probably null
R6972:Kcnh1	UTSW	1	192276836	missense	probably damaging	1.00
R7199:Kcnh1	UTSW	1	192337605	missense	probably benign	0.01
R7219:Kcnh1	UTSW	1	192505637	missense	probably benign
R7749:Kcnh1	UTSW	1	192277139	missense	probably benign
R7799:Kcnh1	UTSW	1	192434875	missense	probably damaging	0.96
R7862:Kcnh1	UTSW	1	192190859	start gained	probably benign
R7945:Kcnh1	UTSW	1	192190859	start gained	probably benign
R8068:Kcnh1	UTSW	1	192241942	missense	probably benign	0.00
Z1176:Kcnh1	UTSW	1	192418737	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGATTCTCCCACACCAAGAG -3'
(R):5'- ACCAAACGTTTTCTGCCGC -3'

Sequencing Primer
(F):5'- GATTCTCCCACACCAAGAGTAACAAG -3'
(R):5'- TGCCGCTCTTGCCCAAG -3'

Posted On

2015-01-23