Incidental Mutation 'R3718:Ubac1'
ID258777
Institutional Source Beutler Lab
Gene Symbol Ubac1
Ensembl Gene ENSMUSG00000036352
Gene Nameubiquitin associated domain containing 1
SynonymsUbadc1, 1110033G07Rik
MMRRC Submission 040710-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R3718 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25998543-26021747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 26014941 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 95 (R95H)
Ref Sequence ENSEMBL: ENSMUSP00000040220 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036509]
Predicted Effect probably damaging
Transcript: ENSMUST00000036509
AA Change: R95H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040220
Gene: ENSMUSG00000036352
AA Change: R95H

DomainStartEndE-ValueType
Blast:UBQ 14 94 2e-38 BLAST
low complexity region 108 123 N/A INTRINSIC
UBA 193 230 2e-5 SMART
low complexity region 245 269 N/A INTRINSIC
low complexity region 280 292 N/A INTRINSIC
UBA 294 331 5.92e-8 SMART
STI1 357 396 1.85e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134990
Predicted Effect probably benign
Transcript: ENSMUST00000136750
SMART Domains Protein: ENSMUSP00000123115
Gene: ENSMUSG00000036352

DomainStartEndE-ValueType
internal_repeat_1 10 37 4.39e-5 PROSPERO
UBA 128 165 2e-5 SMART
low complexity region 180 204 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
UBA 229 258 5.2e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000146363
AA Change: R14H
SMART Domains Protein: ENSMUSP00000117683
Gene: ENSMUSG00000036352
AA Change: R14H

DomainStartEndE-ValueType
low complexity region 28 43 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
UBA 133 170 5.92e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146898
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148725
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150608
Meta Mutation Damage Score 0.1738 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T C 15: 41,866,293 D237G probably benign Het
Alas2 T C X: 150,560,730 probably benign Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Aspm T C 1: 139,480,889 Y2505H probably benign Het
Aspm G A 1: 139,490,427 V2965I probably benign Het
Ccna2 A T 3: 36,566,238 V285E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Dpp3 A G 19: 4,923,065 probably null Het
Gng11 G A 6: 4,008,078 R47H probably benign Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il18r1 A G 1: 40,495,788 E381G probably benign Het
Il9 G A 13: 56,479,451 T116I probably damaging Het
Kcnh1 A G 1: 192,238,799 T129A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Ntsr1 T C 2: 180,542,706 F401L probably benign Het
Nup210 A T 6: 91,020,180 D1626E probably benign Het
Olfr1277 A G 2: 111,270,226 V47A probably benign Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Olfr943 A G 9: 39,185,065 R293G probably damaging Het
Pign A G 1: 105,649,281 probably null Het
Rad54l2 A G 9: 106,693,527 V1198A probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Slc40a1 G T 1: 45,910,991 H434N probably benign Het
Trdv2-1 T C 14: 53,946,538 Y76H probably benign Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Zc3hav1l G T 6: 38,295,125 S236R probably damaging Het
Other mutations in Ubac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01142:Ubac1 APN 2 26006568 missense probably damaging 1.00
PIT4403001:Ubac1 UTSW 2 26006597 missense probably benign 0.16
R0029:Ubac1 UTSW 2 26021443 missense probably benign 0.15
R0121:Ubac1 UTSW 2 26008859 critical splice donor site probably null
R0178:Ubac1 UTSW 2 26021428 missense possibly damaging 0.87
R1839:Ubac1 UTSW 2 26007738 missense possibly damaging 0.70
R1891:Ubac1 UTSW 2 26014962 missense probably benign 0.10
R3716:Ubac1 UTSW 2 26014941 missense probably damaging 1.00
R3717:Ubac1 UTSW 2 26014941 missense probably damaging 1.00
R4602:Ubac1 UTSW 2 25998977 missense probably damaging 1.00
R6742:Ubac1 UTSW 2 26005406 missense possibly damaging 0.89
R7134:Ubac1 UTSW 2 26014962 missense probably benign 0.10
R8056:Ubac1 UTSW 2 26007897 missense probably benign 0.06
RF022:Ubac1 UTSW 2 26005458 missense probably damaging 1.00
Z1177:Ubac1 UTSW 2 26021553 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GTGATGAAGGGCCCCTTATAC -3'
(R):5'- GGAAGTCTGGGGTTGACATC -3'

Sequencing Primer
(F):5'- GATGAAGGGCCCCTTATACCACAC -3'
(R):5'- GAGGCAGAGTCTCTTGTTAAACCC -3'
Posted On2015-01-23