Incidental Mutation 'R3718:Dnajc10'
ID258780
Institutional Source Beutler Lab
Gene Symbol Dnajc10
Ensembl Gene ENSMUSG00000027006
Gene NameDnaJ heat shock protein family (Hsp40) member C10
SynonymsJPDI, ERdj5, D2Ertd706e, 1200006L06Rik
MMRRC Submission 040710-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R3718 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location80315466-80354043 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 80324745 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028392]
PDB Structure
Crystal structure of full-length ERdj5 [X-RAY DIFFRACTION]
Crystal structure of J-Trx1 fragment of ERdj5 [X-RAY DIFFRACTION]
Crystal structure of Trx4 domain of ERdj5 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028392
SMART Domains Protein: ENSMUSP00000028392
Gene: ENSMUSG00000027006

DomainStartEndE-ValueType
DnaJ 34 92 9.73e-26 SMART
Pfam:Thioredoxin 130 232 5.6e-21 PFAM
low complexity region 384 392 N/A INTRINSIC
Pfam:Thioredoxin 454 553 2.3e-21 PFAM
Pfam:Thioredoxin 557 663 2e-21 PFAM
Pfam:Thioredoxin 672 776 5.8e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125000
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum co-chaperone which is part of the endoplasmic reticulum-associated degradation complex involved in recognizing and degrading misfolded proteins. The encoded protein reduces incorrect disulfide bonds in misfolded glycoproteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased endoplasmic reticulum stress in the salivary gland. Female homozygous mutant mice are smaller than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T C 15: 41,866,293 D237G probably benign Het
Alas2 T C X: 150,560,730 probably benign Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Aspm T C 1: 139,480,889 Y2505H probably benign Het
Aspm G A 1: 139,490,427 V2965I probably benign Het
Ccna2 A T 3: 36,566,238 V285E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dpp3 A G 19: 4,923,065 probably null Het
Gng11 G A 6: 4,008,078 R47H probably benign Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il18r1 A G 1: 40,495,788 E381G probably benign Het
Il9 G A 13: 56,479,451 T116I probably damaging Het
Kcnh1 A G 1: 192,238,799 T129A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Ntsr1 T C 2: 180,542,706 F401L probably benign Het
Nup210 A T 6: 91,020,180 D1626E probably benign Het
Olfr1277 A G 2: 111,270,226 V47A probably benign Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Olfr943 A G 9: 39,185,065 R293G probably damaging Het
Pign A G 1: 105,649,281 probably null Het
Rad54l2 A G 9: 106,693,527 V1198A probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Slc40a1 G T 1: 45,910,991 H434N probably benign Het
Trdv2-1 T C 14: 53,946,538 Y76H probably benign Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Zc3hav1l G T 6: 38,295,125 S236R probably damaging Het
Other mutations in Dnajc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Dnajc10 APN 2 80324752 splice site probably benign
IGL01420:Dnajc10 APN 2 80345023 missense possibly damaging 0.81
IGL01466:Dnajc10 APN 2 80321287 missense probably benign 0.00
IGL01645:Dnajc10 APN 2 80340527 missense possibly damaging 0.46
IGL01929:Dnajc10 APN 2 80328076 missense probably damaging 0.99
IGL01958:Dnajc10 APN 2 80321304 splice site probably benign
IGL02205:Dnajc10 APN 2 80349358 missense possibly damaging 0.74
IGL02289:Dnajc10 APN 2 80340526 missense probably damaging 0.98
IGL02661:Dnajc10 APN 2 80326740 splice site probably benign
IGL02865:Dnajc10 APN 2 80331303 missense probably benign
IGL03026:Dnajc10 APN 2 80349303 missense probably damaging 0.96
IGL03407:Dnajc10 APN 2 80346641 missense probably damaging 1.00
PIT4283001:Dnajc10 UTSW 2 80331395 missense probably benign 0.19
R0092:Dnajc10 UTSW 2 80325682 missense probably damaging 0.97
R0457:Dnajc10 UTSW 2 80344946 missense possibly damaging 0.65
R1414:Dnajc10 UTSW 2 80347677 missense probably damaging 0.99
R1739:Dnajc10 UTSW 2 80347662 missense probably benign 0.03
R2126:Dnajc10 UTSW 2 80350734 critical splice donor site probably null
R3717:Dnajc10 UTSW 2 80324745 splice site probably benign
R4020:Dnajc10 UTSW 2 80344952 missense probably damaging 1.00
R4453:Dnajc10 UTSW 2 80346623 missense probably damaging 0.98
R4585:Dnajc10 UTSW 2 80347778 missense probably damaging 1.00
R4586:Dnajc10 UTSW 2 80347778 missense probably damaging 1.00
R4772:Dnajc10 UTSW 2 80340526 missense probably damaging 0.98
R5653:Dnajc10 UTSW 2 80349368 missense probably damaging 1.00
R6157:Dnajc10 UTSW 2 80317391 start gained probably benign
R6263:Dnajc10 UTSW 2 80343948 missense probably damaging 1.00
R6303:Dnajc10 UTSW 2 80350664 missense probably benign 0.07
R6932:Dnajc10 UTSW 2 80331336 missense probably benign
R7104:Dnajc10 UTSW 2 80340815 missense probably damaging 1.00
R7181:Dnajc10 UTSW 2 80319243 nonsense probably null
R7458:Dnajc10 UTSW 2 80324750 splice site probably null
R7842:Dnajc10 UTSW 2 80345065 missense probably benign 0.04
R7925:Dnajc10 UTSW 2 80345065 missense probably benign 0.04
X0018:Dnajc10 UTSW 2 80350674 missense probably damaging 0.97
X0024:Dnajc10 UTSW 2 80344962 missense probably benign 0.19
Z1177:Dnajc10 UTSW 2 80319233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCAGTGAACTATTTAGGACTG -3'
(R):5'- TGACAGCTCCGATTCGAAGC -3'

Sequencing Primer
(F):5'- TGCTGTCAACTCTGGAGA -3'
(R):5'- TAGCAAATTCTCTCCACTATGACAG -3'
Posted On2015-01-23