Incidental Mutation 'R3718:Olfr1277'
ID258781
Institutional Source Beutler Lab
Gene Symbol Olfr1277
Ensembl Gene ENSMUSG00000074965
Gene Nameolfactory receptor 1277
SynonymsMOR248-11, GA_x6K02T2Q125-72321818-72320907
MMRRC Submission 040710-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R3718 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111264946-111274106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111270226 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 47 (V47A)
Ref Sequence ENSEMBL: ENSMUSP00000150703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099619] [ENSMUST00000214760]
Predicted Effect probably benign
Transcript: ENSMUST00000099619
AA Change: V47A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097214
Gene: ENSMUSG00000074965
AA Change: V47A

DomainStartEndE-ValueType
Pfam:7tm_4 31 303 5.5e-50 PFAM
Pfam:7tm_1 41 287 7.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214760
AA Change: V47A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T C 15: 41,866,293 D237G probably benign Het
Alas2 T C X: 150,560,730 probably benign Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Aspm T C 1: 139,480,889 Y2505H probably benign Het
Aspm G A 1: 139,490,427 V2965I probably benign Het
Ccna2 A T 3: 36,566,238 V285E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Dpp3 A G 19: 4,923,065 probably null Het
Gng11 G A 6: 4,008,078 R47H probably benign Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il18r1 A G 1: 40,495,788 E381G probably benign Het
Il9 G A 13: 56,479,451 T116I probably damaging Het
Kcnh1 A G 1: 192,238,799 T129A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Ntsr1 T C 2: 180,542,706 F401L probably benign Het
Nup210 A T 6: 91,020,180 D1626E probably benign Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Olfr943 A G 9: 39,185,065 R293G probably damaging Het
Pign A G 1: 105,649,281 probably null Het
Rad54l2 A G 9: 106,693,527 V1198A probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Slc40a1 G T 1: 45,910,991 H434N probably benign Het
Trdv2-1 T C 14: 53,946,538 Y76H probably benign Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Zc3hav1l G T 6: 38,295,125 S236R probably damaging Het
Other mutations in Olfr1277
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01552:Olfr1277 APN 2 111269912 missense probably damaging 1.00
IGL02550:Olfr1277 APN 2 111270004 missense probably damaging 0.99
IGL02661:Olfr1277 APN 2 111269466 missense possibly damaging 0.56
IGL02940:Olfr1277 APN 2 111269728 missense probably damaging 0.99
R0121:Olfr1277 UTSW 2 111270314 missense probably benign 0.01
R0402:Olfr1277 UTSW 2 111269863 missense probably damaging 1.00
R0903:Olfr1277 UTSW 2 111270356 missense probably benign
R1804:Olfr1277 UTSW 2 111269930 missense probably benign
R1806:Olfr1277 UTSW 2 111270277 missense possibly damaging 0.65
R1965:Olfr1277 UTSW 2 111269593 missense probably damaging 1.00
R4044:Olfr1277 UTSW 2 111269582 missense probably benign 0.01
R4401:Olfr1277 UTSW 2 111269833 missense probably damaging 1.00
R4518:Olfr1277 UTSW 2 111269918 missense probably benign
R5309:Olfr1277 UTSW 2 111270310 missense probably benign 0.00
R5312:Olfr1277 UTSW 2 111270310 missense probably benign 0.00
R5367:Olfr1277 UTSW 2 111269890 missense possibly damaging 0.81
R5727:Olfr1277 UTSW 2 111269852 nonsense probably null
R5772:Olfr1277 UTSW 2 111269712 nonsense probably null
R5827:Olfr1277 UTSW 2 111269921 missense probably damaging 1.00
R5882:Olfr1277 UTSW 2 111270139 missense probably damaging 0.99
R6036:Olfr1277 UTSW 2 111269612 missense probably damaging 1.00
R6036:Olfr1277 UTSW 2 111269612 missense probably damaging 1.00
R6728:Olfr1277 UTSW 2 111269673 missense probably benign 0.00
R7629:Olfr1277 UTSW 2 111269876 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTCCAAAGAAAATCTGACACATGC -3'
(R):5'- GCTAAGGTCATTTCCAAAGTTAGAAGG -3'

Sequencing Primer
(F):5'- TGCACCCTCCAAAAGAGATCGTC -3'
(R):5'- CCAAAGTTAGAAGGTTCAATCACTTC -3'
Posted On2015-01-23