Incidental Mutation 'R3718:Ntsr1'
ID258782
Institutional Source Beutler Lab
Gene Symbol Ntsr1
Ensembl Gene ENSMUSG00000027568
Gene Nameneurotensin receptor 1
SynonymsNtsr1, NTR1, NTR-1, NT-1R
MMRRC Submission 040710-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R3718 (G1)
Quality Score151
Status Validated
Chromosome2
Chromosomal Location180499976-180544980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 180542706 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 401 (F401L)
Ref Sequence ENSEMBL: ENSMUSP00000127548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029084] [ENSMUST00000170448]
Predicted Effect probably benign
Transcript: ENSMUST00000029084
AA Change: F401L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000029084
Gene: ENSMUSG00000027568
AA Change: F401L

DomainStartEndE-ValueType
low complexity region 31 49 N/A INTRINSIC
Pfam:7tm_1 80 369 7.5e-55 PFAM
Pfam:7TM_GPCR_Srv 82 386 1e-8 PFAM
low complexity region 392 398 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170448
AA Change: F401L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127548
Gene: ENSMUSG00000027568
AA Change: F401L

DomainStartEndE-ValueType
low complexity region 31 49 N/A INTRINSIC
Pfam:7tm_4 70 283 6.7e-9 PFAM
Pfam:7tm_1 80 369 2e-51 PFAM
Pfam:7TM_GPCR_Srv 83 386 1.8e-8 PFAM
low complexity region 392 398 N/A INTRINSIC
Meta Mutation Damage Score 0.0703 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotensin receptor 1 belongs to the large superfamily of G-protein coupled receptors. NTSR1 mediates the multiple functions of neurotensin, such as hypotension, hyperglycemia, hypothermia, antinociception, and regulation of intestinal motility and secretion. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice deficient for this marker have normal baseline prepulse inhibition responses and acoustic startle responses. Mice are heavier, eat more, and have lower body temperatures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T C 15: 41,866,293 D237G probably benign Het
Alas2 T C X: 150,560,730 probably benign Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Aspm T C 1: 139,480,889 Y2505H probably benign Het
Aspm G A 1: 139,490,427 V2965I probably benign Het
Ccna2 A T 3: 36,566,238 V285E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Dpp3 A G 19: 4,923,065 probably null Het
Gng11 G A 6: 4,008,078 R47H probably benign Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il18r1 A G 1: 40,495,788 E381G probably benign Het
Il9 G A 13: 56,479,451 T116I probably damaging Het
Kcnh1 A G 1: 192,238,799 T129A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Nup210 A T 6: 91,020,180 D1626E probably benign Het
Olfr1277 A G 2: 111,270,226 V47A probably benign Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Olfr943 A G 9: 39,185,065 R293G probably damaging Het
Pign A G 1: 105,649,281 probably null Het
Rad54l2 A G 9: 106,693,527 V1198A probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Slc40a1 G T 1: 45,910,991 H434N probably benign Het
Trdv2-1 T C 14: 53,946,538 Y76H probably benign Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Zc3hav1l G T 6: 38,295,125 S236R probably damaging Het
Other mutations in Ntsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Ntsr1 APN 2 180542542 missense probably damaging 0.99
IGL01765:Ntsr1 APN 2 180538717 missense possibly damaging 0.56
IGL02137:Ntsr1 APN 2 180538835 critical splice donor site probably null
IGL02321:Ntsr1 APN 2 180538834 critical splice donor site probably null
IGL03349:Ntsr1 APN 2 180500502 missense probably benign
R0482:Ntsr1 UTSW 2 180501056 missense possibly damaging 0.54
R0542:Ntsr1 UTSW 2 180542581 missense probably damaging 1.00
R1081:Ntsr1 UTSW 2 180538756 missense probably benign 0.14
R1241:Ntsr1 UTSW 2 180500601 missense probably damaging 1.00
R1540:Ntsr1 UTSW 2 180542647 missense probably damaging 0.99
R4206:Ntsr1 UTSW 2 180500752 missense probably damaging 1.00
R5481:Ntsr1 UTSW 2 180541520 missense possibly damaging 0.79
R5703:Ntsr1 UTSW 2 180500433 missense probably damaging 0.98
R5975:Ntsr1 UTSW 2 180500788 missense probably damaging 1.00
R6643:Ntsr1 UTSW 2 180500926 missense probably damaging 1.00
R6754:Ntsr1 UTSW 2 180542683 missense probably benign 0.00
R7295:Ntsr1 UTSW 2 180500932 missense probably damaging 1.00
R7316:Ntsr1 UTSW 2 180500752 missense probably damaging 1.00
R7765:Ntsr1 UTSW 2 180538817 missense probably damaging 0.99
R7822:Ntsr1 UTSW 2 180538690 missense probably damaging 1.00
R8087:Ntsr1 UTSW 2 180500172 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGGAGTCTAAACATCCTCTCCTCC -3'
(R):5'- CTGGGAAGAAAGAAGCCTCC -3'

Sequencing Primer
(F):5'- CCAACAGGTTCCTCTTCGAC -3'
(R):5'- TCACCGGCATGGCTTAGATG -3'
Posted On2015-01-23