Incidental Mutation 'R3718:Dab1'
ID258786
Institutional Source Beutler Lab
Gene Symbol Dab1
Ensembl Gene ENSMUSG00000028519
Gene Namedisabled 1
SynonymsC630028C02Rik
MMRRC Submission 040710-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.872) question?
Stock #R3718 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location103619359-104744844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104731751 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 524 (A524V)
Ref Sequence ENSEMBL: ENSMUSP00000102443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106830] [ENSMUST00000146078]
Predicted Effect probably benign
Transcript: ENSMUST00000106830
AA Change: A524V

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102443
Gene: ENSMUSG00000028519
AA Change: A524V

DomainStartEndE-ValueType
PTB 37 171 3.51e-36 SMART
low complexity region 254 267 N/A INTRINSIC
low complexity region 470 487 N/A INTRINSIC
low complexity region 490 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146078
SMART Domains Protein: ENSMUSP00000125033
Gene: ENSMUSG00000028519

DomainStartEndE-ValueType
PTB 37 171 3.51e-36 SMART
low complexity region 235 242 N/A INTRINSIC
Meta Mutation Damage Score 0.2232 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The laminar organization of multiple neuronal types in the cerebral cortex is required for normal cognitive function. In mice, the disabled-1 gene plays a central role in brain development, directing the migration of cortical neurons past previously formed neurons to reach their proper layer. This gene is similar to disabled-1, and the protein encoded by this gene is thought to be a signal transducer that interacts with protein kinase pathways to regulate neuronal positioning in the developing brain. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous null display unstable gait and whole-body tremor with a hypoplastic cerebellum devoid of folia, a probable consequence of defective neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T C 15: 41,866,293 D237G probably benign Het
Alas2 T C X: 150,560,730 probably benign Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Aspm T C 1: 139,480,889 Y2505H probably benign Het
Aspm G A 1: 139,490,427 V2965I probably benign Het
Ccna2 A T 3: 36,566,238 V285E probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Dpp3 A G 19: 4,923,065 probably null Het
Gng11 G A 6: 4,008,078 R47H probably benign Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il18r1 A G 1: 40,495,788 E381G probably benign Het
Il9 G A 13: 56,479,451 T116I probably damaging Het
Kcnh1 A G 1: 192,238,799 T129A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Ntsr1 T C 2: 180,542,706 F401L probably benign Het
Nup210 A T 6: 91,020,180 D1626E probably benign Het
Olfr1277 A G 2: 111,270,226 V47A probably benign Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Olfr943 A G 9: 39,185,065 R293G probably damaging Het
Pign A G 1: 105,649,281 probably null Het
Rad54l2 A G 9: 106,693,527 V1198A probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Slc40a1 G T 1: 45,910,991 H434N probably benign Het
Trdv2-1 T C 14: 53,946,538 Y76H probably benign Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Zc3hav1l G T 6: 38,295,125 S236R probably damaging Het
Other mutations in Dab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dab1 APN 4 104678810 missense probably damaging 1.00
IGL00087:Dab1 APN 4 104678753 missense possibly damaging 0.90
IGL00328:Dab1 APN 4 104688438 missense possibly damaging 0.55
IGL00756:Dab1 APN 4 104727878 missense probably benign
IGL02074:Dab1 APN 4 104727854 missense possibly damaging 0.90
IGL02286:Dab1 APN 4 104680070 missense probably damaging 1.00
IGL02986:Dab1 APN 4 104479221 missense probably benign 0.00
IGL03008:Dab1 APN 4 104727580 missense probably damaging 0.99
IGL03133:Dab1 APN 4 104727580 missense probably benign 0.41
IGL03375:Dab1 APN 4 104681601 missense possibly damaging 0.70
LCD18:Dab1 UTSW 4 104046572 intron probably benign
R0027:Dab1 UTSW 4 104704199 intron probably benign
R0466:Dab1 UTSW 4 104720550 missense probably benign 0.15
R0838:Dab1 UTSW 4 104731751 missense probably benign 0.29
R0840:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1086:Dab1 UTSW 4 104328572 intron probably benign
R1598:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1640:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1699:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1749:Dab1 UTSW 4 104328298 intron probably benign
R1770:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1846:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1847:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1848:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1885:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1986:Dab1 UTSW 4 104613215 missense probably damaging 0.97
R1990:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2006:Dab1 UTSW 4 104605325 missense probably damaging 1.00
R2030:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2032:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2034:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2061:Dab1 UTSW 4 104678741 missense probably damaging 1.00
R2088:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2089:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2091:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2091:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2092:Dab1 UTSW 4 104678777 missense probably damaging 1.00
R2193:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2194:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2361:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2362:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2391:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2424:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2865:Dab1 UTSW 4 104680146 missense probably benign
R3118:Dab1 UTSW 4 104680069 critical splice acceptor site probably null
R3716:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3740:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3742:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3965:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4057:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4393:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4396:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4418:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4607:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4608:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4648:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4693:Dab1 UTSW 4 104679553 missense probably damaging 1.00
R4701:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4730:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4760:Dab1 UTSW 4 104732145 missense probably damaging 1.00
R4927:Dab1 UTSW 4 104704252 missense probably benign
R5173:Dab1 UTSW 4 104688448 splice site probably null
R5503:Dab1 UTSW 4 104512264 missense probably benign 0.01
R6199:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6200:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6207:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6224:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6227:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6228:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6229:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6246:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6247:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6248:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6249:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6250:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6258:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6259:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6260:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6505:Dab1 UTSW 4 104512264 missense probably benign 0.01
R6817:Dab1 UTSW 4 104679546 missense probably damaging 1.00
R7305:Dab1 UTSW 4 104713790 missense
R7709:Dab1 UTSW 4 104720559 nonsense probably null
R7894:Dab1 UTSW 4 104732138 missense probably benign 0.03
R7977:Dab1 UTSW 4 104732138 missense probably benign 0.03
RF017:Dab1 UTSW 4 104713652 missense probably benign 0.01
Z1088:Dab1 UTSW 4 104479232 missense probably damaging 0.99
Z1176:Dab1 UTSW 4 104728078 missense probably benign 0.00
Z1177:Dab1 UTSW 4 104727740 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GAGACCTCAGGTATCTTTATGGG -3'
(R):5'- TACAGGAGGCTGAAACTTCCC -3'

Sequencing Primer
(F):5'- ATGGGATATAAATGGCTGTGGC -3'
(R):5'- TGAAACTTCCCCCAGAGGATG -3'
Posted On2015-01-23