Incidental Mutation 'R3718:Zc3hav1l'
ID258791
Institutional Source Beutler Lab
Gene Symbol Zc3hav1l
Ensembl Gene ENSMUSG00000047749
Gene Namezinc finger CCCH-type, antiviral 1-like
SynonymsE430016P22Rik, B130055L09Rik
MMRRC Submission 040710-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3718 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location38287396-38299259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 38295125 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 236 (S236R)
Ref Sequence ENSEMBL: ENSMUSP00000062475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058524]
Predicted Effect probably damaging
Transcript: ENSMUST00000058524
AA Change: S236R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062475
Gene: ENSMUSG00000047749
AA Change: S236R

DomainStartEndE-ValueType
low complexity region 63 81 N/A INTRINSIC
internal_repeat_1 106 133 4.92e-5 PROSPERO
internal_repeat_1 193 220 4.92e-5 PROSPERO
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T C 15: 41,866,293 D237G probably benign Het
Alas2 T C X: 150,560,730 probably benign Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Aspm T C 1: 139,480,889 Y2505H probably benign Het
Aspm G A 1: 139,490,427 V2965I probably benign Het
Ccna2 A T 3: 36,566,238 V285E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Dpp3 A G 19: 4,923,065 probably null Het
Gng11 G A 6: 4,008,078 R47H probably benign Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il18r1 A G 1: 40,495,788 E381G probably benign Het
Il9 G A 13: 56,479,451 T116I probably damaging Het
Kcnh1 A G 1: 192,238,799 T129A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Ntsr1 T C 2: 180,542,706 F401L probably benign Het
Nup210 A T 6: 91,020,180 D1626E probably benign Het
Olfr1277 A G 2: 111,270,226 V47A probably benign Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Olfr943 A G 9: 39,185,065 R293G probably damaging Het
Pign A G 1: 105,649,281 probably null Het
Rad54l2 A G 9: 106,693,527 V1198A probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Slc40a1 G T 1: 45,910,991 H434N probably benign Het
Trdv2-1 T C 14: 53,946,538 Y76H probably benign Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Other mutations in Zc3hav1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0070:Zc3hav1l UTSW 6 38295190 missense probably damaging 1.00
R0070:Zc3hav1l UTSW 6 38295190 missense probably damaging 1.00
R1833:Zc3hav1l UTSW 6 38297946 splice site probably benign
R6034:Zc3hav1l UTSW 6 38295280 missense probably damaging 1.00
R6034:Zc3hav1l UTSW 6 38295280 missense probably damaging 1.00
R6101:Zc3hav1l UTSW 6 38293077 missense probably benign
R6105:Zc3hav1l UTSW 6 38293077 missense probably benign
R7315:Zc3hav1l UTSW 6 38295147 missense possibly damaging 0.94
R7352:Zc3hav1l UTSW 6 38298981 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGCTGACTTCCATTCACTGC -3'
(R):5'- CGATGTCCTTTATGGCTACTGC -3'

Sequencing Primer
(F):5'- TGTGTTAAAACAGCGGCTCC -3'
(R):5'- CTACTGCAGCCTCAAGGATAGATG -3'
Posted On2015-01-23