Incidental Mutation 'R3718:Nup210'
ID258792
Institutional Source Beutler Lab
Gene Symbol Nup210
Ensembl Gene ENSMUSG00000030091
Gene Namenucleoporin 210
Synonymsgp190, Pom210, gp210
MMRRC Submission 040710-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3718 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location91013068-91116829 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91020180 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1626 (D1626E)
Ref Sequence ENSEMBL: ENSMUSP00000032179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032179] [ENSMUST00000113509] [ENSMUST00000142951]
Predicted Effect probably benign
Transcript: ENSMUST00000032179
AA Change: D1626E

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000032179
Gene: ENSMUSG00000030091
AA Change: D1626E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Blast:BID_2 450 527 3e-29 BLAST
low complexity region 850 862 N/A INTRINSIC
Blast:S1 937 1022 6e-37 BLAST
BID_2 1077 1152 8.36e-6 SMART
low complexity region 1159 1168 N/A INTRINSIC
Blast:BID_2 1468 1551 3e-35 BLAST
transmembrane domain 1809 1831 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113509
AA Change: D1582E

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000109137
Gene: ENSMUSG00000030091
AA Change: D1582E

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Blast:BID_2 450 527 4e-29 BLAST
low complexity region 806 818 N/A INTRINSIC
Blast:S1 893 978 4e-37 BLAST
BID_2 1033 1108 8.36e-6 SMART
low complexity region 1115 1124 N/A INTRINSIC
Blast:BID_2 1424 1507 3e-35 BLAST
transmembrane domain 1765 1787 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141952
Predicted Effect probably benign
Transcript: ENSMUST00000142951
AA Change: D839E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000120098
Gene: ENSMUSG00000030091
AA Change: D839E

DomainStartEndE-ValueType
low complexity region 63 75 N/A INTRINSIC
Blast:S1 150 235 3e-37 BLAST
BID_2 290 365 8.36e-6 SMART
low complexity region 372 381 N/A INTRINSIC
Blast:BID_2 681 764 1e-35 BLAST
transmembrane domain 1022 1044 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148397
Meta Mutation Damage Score 0.7632 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. The protein encoded by this gene is a membrane-spanning glycoprotein that is a major component of the nuclear pore complex. Multiple pseudogenes related to this gene are located on chromosome 3. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T C 15: 41,866,293 D237G probably benign Het
Alas2 T C X: 150,560,730 probably benign Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Aspm T C 1: 139,480,889 Y2505H probably benign Het
Aspm G A 1: 139,490,427 V2965I probably benign Het
Ccna2 A T 3: 36,566,238 V285E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Dpp3 A G 19: 4,923,065 probably null Het
Gng11 G A 6: 4,008,078 R47H probably benign Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il18r1 A G 1: 40,495,788 E381G probably benign Het
Il9 G A 13: 56,479,451 T116I probably damaging Het
Kcnh1 A G 1: 192,238,799 T129A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Ntsr1 T C 2: 180,542,706 F401L probably benign Het
Olfr1277 A G 2: 111,270,226 V47A probably benign Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Olfr943 A G 9: 39,185,065 R293G probably damaging Het
Pign A G 1: 105,649,281 probably null Het
Rad54l2 A G 9: 106,693,527 V1198A probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Slc40a1 G T 1: 45,910,991 H434N probably benign Het
Trdv2-1 T C 14: 53,946,538 Y76H probably benign Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Zc3hav1l G T 6: 38,295,125 S236R probably damaging Het
Other mutations in Nup210
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01139:Nup210 APN 6 91030097 missense possibly damaging 0.92
IGL01532:Nup210 APN 6 91085999 splice site probably benign
IGL01574:Nup210 APN 6 91040564 missense probably benign 0.35
IGL01621:Nup210 APN 6 91030117 missense probably damaging 1.00
IGL01976:Nup210 APN 6 91053614 missense possibly damaging 0.89
IGL02089:Nup210 APN 6 91076698 missense probably benign 0.04
IGL02291:Nup210 APN 6 91101268 missense probably damaging 1.00
IGL03013:Nup210 APN 6 91053379 missense probably benign 0.00
IGL03046:Nup210 APN 6 91018996 splice site probably benign
IGL03136:Nup210 APN 6 91028861 missense probably benign 0.32
IGL03139:Nup210 APN 6 91020239 missense probably benign 0.08
IGL03195:Nup210 APN 6 91015850 missense probably benign 0.32
IGL03344:Nup210 APN 6 91021429 missense possibly damaging 0.53
brotherhood UTSW 6 91036469 missense possibly damaging 0.81
equality UTSW 6 91021395 critical splice donor site probably null
Liberty UTSW 6 91020180 missense probably benign 0.04
unity UTSW 6 91031668 nonsense probably null
IGL03134:Nup210 UTSW 6 91030190 missense probably damaging 0.99
PIT4810001:Nup210 UTSW 6 91030124 missense probably damaging 1.00
R0100:Nup210 UTSW 6 91069193 missense probably benign 0.04
R0348:Nup210 UTSW 6 91074310 missense probably benign 0.27
R0385:Nup210 UTSW 6 91028795 missense possibly damaging 0.77
R0551:Nup210 UTSW 6 91021484 missense possibly damaging 0.85
R0606:Nup210 UTSW 6 91026929 missense possibly damaging 0.89
R1053:Nup210 UTSW 6 91028811 missense probably benign 0.41
R1301:Nup210 UTSW 6 91042347 missense possibly damaging 0.47
R1381:Nup210 UTSW 6 91075960 missense probably damaging 0.99
R1464:Nup210 UTSW 6 91053569 missense possibly damaging 0.82
R1464:Nup210 UTSW 6 91053569 missense possibly damaging 0.82
R1487:Nup210 UTSW 6 91042576 missense probably damaging 1.00
R1522:Nup210 UTSW 6 91069166 missense possibly damaging 0.85
R1529:Nup210 UTSW 6 91036376 missense probably damaging 1.00
R1531:Nup210 UTSW 6 91034841 missense probably benign 0.05
R1668:Nup210 UTSW 6 91028805 missense possibly damaging 0.89
R1694:Nup210 UTSW 6 91062803 missense probably benign 0.09
R1803:Nup210 UTSW 6 91074282 missense probably damaging 0.99
R1851:Nup210 UTSW 6 91016054 missense probably damaging 1.00
R2145:Nup210 UTSW 6 91028876 missense possibly damaging 0.81
R2196:Nup210 UTSW 6 91055244 missense probably benign 0.02
R2308:Nup210 UTSW 6 91040868 missense probably benign 0.19
R2419:Nup210 UTSW 6 91017556 splice site probably benign
R2912:Nup210 UTSW 6 91026974 missense probably damaging 1.00
R3413:Nup210 UTSW 6 91025242 missense probably benign 0.00
R3753:Nup210 UTSW 6 91021395 critical splice donor site probably null
R4058:Nup210 UTSW 6 91060620 missense probably benign 0.02
R4840:Nup210 UTSW 6 91031668 nonsense probably null
R4912:Nup210 UTSW 6 91017529 missense probably benign 0.01
R4967:Nup210 UTSW 6 91036469 missense possibly damaging 0.81
R4996:Nup210 UTSW 6 91053436 missense probably benign 0.16
R5074:Nup210 UTSW 6 91055327 missense probably benign 0.16
R5233:Nup210 UTSW 6 91026969 missense probably damaging 1.00
R5352:Nup210 UTSW 6 91069316 missense probably damaging 1.00
R5490:Nup210 UTSW 6 91085988 missense probably damaging 0.98
R5511:Nup210 UTSW 6 91026963 missense probably damaging 0.97
R5773:Nup210 UTSW 6 91085883 missense probably damaging 0.96
R6064:Nup210 UTSW 6 91055291 missense probably benign 0.01
R6209:Nup210 UTSW 6 91025355 missense probably benign
R6299:Nup210 UTSW 6 91074288 missense possibly damaging 0.68
R6705:Nup210 UTSW 6 91087960 missense possibly damaging 0.50
R6855:Nup210 UTSW 6 91040853 missense probably benign 0.13
R6856:Nup210 UTSW 6 91087913 nonsense probably null
R6911:Nup210 UTSW 6 91030130 missense probably damaging 0.98
R6955:Nup210 UTSW 6 91087927 missense probably damaging 1.00
R7045:Nup210 UTSW 6 91054451 missense probably damaging 1.00
R7081:Nup210 UTSW 6 91060665 missense possibly damaging 0.50
R7163:Nup210 UTSW 6 91073331 missense probably damaging 1.00
R7305:Nup210 UTSW 6 91087966 missense probably damaging 1.00
R7387:Nup210 UTSW 6 91021396 critical splice donor site probably null
R7404:Nup210 UTSW 6 91073245 missense probably benign 0.01
R7469:Nup210 UTSW 6 91018892 missense probably benign 0.08
R7603:Nup210 UTSW 6 91076697 missense probably benign 0.00
R7731:Nup210 UTSW 6 91071888 missense possibly damaging 0.50
R7822:Nup210 UTSW 6 91018777 missense possibly damaging 0.71
R8032:Nup210 UTSW 6 91074349 missense probably benign 0.02
R8039:Nup210 UTSW 6 91070233 missense probably benign 0.09
R8081:Nup210 UTSW 6 91076675 missense probably benign 0.00
R8177:Nup210 UTSW 6 91014488 missense probably benign
X0067:Nup210 UTSW 6 91074280 missense probably damaging 1.00
Z1177:Nup210 UTSW 6 91020185 missense probably benign
Z1177:Nup210 UTSW 6 91087907 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTATAGCCTAACAACGCCAGG -3'
(R):5'- ATTGACTGCTGAGCTCCCTG -3'

Sequencing Primer
(F):5'- TAACAACGCCAGGCTGGACTC -3'
(R):5'- AACAGGATTGGATACTGGTGCTATG -3'
Posted On2015-01-23