Incidental Mutation 'R3718:Olfr943'
ID258794
Institutional Source Beutler Lab
Gene Symbol Olfr943
Ensembl Gene ENSMUSG00000094970
Gene Nameolfactory receptor 943
SynonymsGA_x6K02T2PVTD-32881408-32882343, MOR171-44
MMRRC Submission 040710-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R3718 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location39166304-39192350 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 39185065 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 293 (R293G)
Ref Sequence ENSEMBL: ENSMUSP00000148896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071617] [ENSMUST00000213176] [ENSMUST00000213507] [ENSMUST00000213830] [ENSMUST00000215770]
Predicted Effect probably damaging
Transcript: ENSMUST00000071617
AA Change: R296G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071545
Gene: ENSMUSG00000094970
AA Change: R296G

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 27 183 9.4e-7 PFAM
Pfam:7tm_4 34 311 7.4e-55 PFAM
Pfam:7tm_1 44 293 6.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213176
AA Change: R293G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000213507
AA Change: R293G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213716
Predicted Effect probably damaging
Transcript: ENSMUST00000213830
AA Change: R293G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000215770
AA Change: R293G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5418 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T C 15: 41,866,293 D237G probably benign Het
Alas2 T C X: 150,560,730 probably benign Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Aspm T C 1: 139,480,889 Y2505H probably benign Het
Aspm G A 1: 139,490,427 V2965I probably benign Het
Ccna2 A T 3: 36,566,238 V285E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Dpp3 A G 19: 4,923,065 probably null Het
Gng11 G A 6: 4,008,078 R47H probably benign Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il18r1 A G 1: 40,495,788 E381G probably benign Het
Il9 G A 13: 56,479,451 T116I probably damaging Het
Kcnh1 A G 1: 192,238,799 T129A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Ntsr1 T C 2: 180,542,706 F401L probably benign Het
Nup210 A T 6: 91,020,180 D1626E probably benign Het
Olfr1277 A G 2: 111,270,226 V47A probably benign Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Pign A G 1: 105,649,281 probably null Het
Rad54l2 A G 9: 106,693,527 V1198A probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Slc40a1 G T 1: 45,910,991 H434N probably benign Het
Trdv2-1 T C 14: 53,946,538 Y76H probably benign Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Zc3hav1l G T 6: 38,295,125 S236R probably damaging Het
Other mutations in Olfr943
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Olfr943 APN 9 39185092 missense possibly damaging 0.93
IGL02858:Olfr943 APN 9 39184526 missense probably damaging 1.00
IGL02890:Olfr943 APN 9 39184268 missense probably damaging 1.00
IGL02996:Olfr943 APN 9 39185065 missense probably damaging 1.00
R0334:Olfr943 UTSW 9 39184684 missense probably benign 0.01
R0881:Olfr943 UTSW 9 39184688 missense probably benign 0.00
R2474:Olfr943 UTSW 9 39184550 missense probably damaging 1.00
R4358:Olfr943 UTSW 9 39184568 missense probably damaging 1.00
R4740:Olfr943 UTSW 9 39184368 nonsense probably null
R4763:Olfr943 UTSW 9 39184960 missense probably benign 0.15
R4788:Olfr943 UTSW 9 39184612 missense probably benign 0.15
R4824:Olfr943 UTSW 9 39184205 missense probably benign 0.02
R4866:Olfr943 UTSW 9 39185071 missense probably damaging 1.00
R5560:Olfr943 UTSW 9 39184184 missense probably benign 0.06
R6278:Olfr943 UTSW 9 39184298 missense probably damaging 1.00
R7003:Olfr943 UTSW 9 39184943 missense probably benign 0.01
R7721:Olfr943 UTSW 9 39184760 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCCTTCAGTACTTGCAGTTCC -3'
(R):5'- CCAACGGGAATAAGGATCCATG -3'

Sequencing Primer
(F):5'- AGTACTTGCAGTTCCCACATC -3'
(R):5'- AGTAAAAGTTCTCAAACAATCCTAGC -3'
Posted On2015-01-23