Incidental Mutation 'R3718:Trim43c'
ID258795
Institutional Source Beutler Lab
Gene Symbol Trim43c
Ensembl Gene ENSMUSG00000067399
Gene Nametripartite motif-containing 43C
SynonymsTrim43
MMRRC Submission 040710-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R3718 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location88839164-88848190 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88844977 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 286 (S286P)
Ref Sequence ENSEMBL: ENSMUSP00000129255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163255] [ENSMUST00000186363]
Predicted Effect probably benign
Transcript: ENSMUST00000163255
AA Change: S286P

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129255
Gene: ENSMUSG00000067399
AA Change: S286P

DomainStartEndE-ValueType
RING 16 56 3.34e-6 SMART
PDB:2IWG|E 329 446 3e-15 PDB
Blast:SPRY 336 441 3e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180712
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180783
Predicted Effect probably benign
Transcript: ENSMUST00000186363
AA Change: S285P

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000139715
Gene: ENSMUSG00000067399
AA Change: S285P

DomainStartEndE-ValueType
RING 16 56 1.6e-8 SMART
SPRY 334 445 6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188156
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (36/37)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T C 15: 41,866,293 D237G probably benign Het
Alas2 T C X: 150,560,730 probably benign Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Aspm T C 1: 139,480,889 Y2505H probably benign Het
Aspm G A 1: 139,490,427 V2965I probably benign Het
Ccna2 A T 3: 36,566,238 V285E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Dpp3 A G 19: 4,923,065 probably null Het
Gng11 G A 6: 4,008,078 R47H probably benign Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il18r1 A G 1: 40,495,788 E381G probably benign Het
Il9 G A 13: 56,479,451 T116I probably damaging Het
Kcnh1 A G 1: 192,238,799 T129A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Ntsr1 T C 2: 180,542,706 F401L probably benign Het
Nup210 A T 6: 91,020,180 D1626E probably benign Het
Olfr1277 A G 2: 111,270,226 V47A probably benign Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Olfr943 A G 9: 39,185,065 R293G probably damaging Het
Pign A G 1: 105,649,281 probably null Het
Rad54l2 A G 9: 106,693,527 V1198A probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Slc40a1 G T 1: 45,910,991 H434N probably benign Het
Trdv2-1 T C 14: 53,946,538 Y76H probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Zc3hav1l G T 6: 38,295,125 S236R probably damaging Het
Other mutations in Trim43c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Trim43c APN 9 88841856 missense probably benign 0.20
IGL02414:Trim43c APN 9 88841832 critical splice acceptor site probably null
R0054:Trim43c UTSW 9 88847515 missense probably damaging 1.00
R0765:Trim43c UTSW 9 88841916 missense probably benign 0.28
R0862:Trim43c UTSW 9 88843034 missense probably benign 0.01
R0864:Trim43c UTSW 9 88843034 missense probably benign 0.01
R1117:Trim43c UTSW 9 88844977 missense probably benign 0.20
R1222:Trim43c UTSW 9 88843078 missense possibly damaging 0.70
R1643:Trim43c UTSW 9 88847477 missense probably damaging 0.97
R1691:Trim43c UTSW 9 88840699 missense probably damaging 0.98
R1914:Trim43c UTSW 9 88840617 missense probably benign 0.01
R3772:Trim43c UTSW 9 88847757 missense probably damaging 1.00
R3852:Trim43c UTSW 9 88840401 missense probably damaging 1.00
R4774:Trim43c UTSW 9 88847652 missense possibly damaging 0.48
R5784:Trim43c UTSW 9 88847643 missense probably benign 0.03
R5833:Trim43c UTSW 9 88843037 missense possibly damaging 0.74
R6177:Trim43c UTSW 9 88840547 missense possibly damaging 0.50
R6407:Trim43c UTSW 9 88840414 missense probably benign
R6490:Trim43c UTSW 9 88844950 missense possibly damaging 0.50
R6892:Trim43c UTSW 9 88844924 missense probably benign 0.35
R8050:Trim43c UTSW 9 88840337 missense probably damaging 0.99
Z1088:Trim43c UTSW 9 88842935 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAATTTGCTATGAATACCTATGTGAGT -3'
(R):5'- ACAATGTGGCTTAACTAGACATCTT -3'

Sequencing Primer
(F):5'- ACCATGGGTTCCTGGGATTGAAC -3'
(R):5'- GGTGGCTCACAACCATCTGTAATG -3'
Posted On2015-01-23