Incidental Mutation 'R3718:Abra'
ID258799
Institutional Source Beutler Lab
Gene Symbol Abra
Ensembl Gene ENSMUSG00000042895
Gene Nameactin-binding Rho activating protein
SynonymsSTARS, C130068O12Rik
MMRRC Submission 040710-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.303) question?
Stock #R3718 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location41864076-41869720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41866293 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 237 (D237G)
Ref Sequence ENSEMBL: ENSMUSP00000051973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054742]
Predicted Effect probably benign
Transcript: ENSMUST00000054742
AA Change: D237G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000051973
Gene: ENSMUSG00000042895
AA Change: D237G

DomainStartEndE-ValueType
Costars 298 374 6.22e-45 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (36/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired arteriogenesis following occlusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alas2 T C X: 150,560,730 probably benign Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Aspm T C 1: 139,480,889 Y2505H probably benign Het
Aspm G A 1: 139,490,427 V2965I probably benign Het
Ccna2 A T 3: 36,566,238 V285E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Dpp3 A G 19: 4,923,065 probably null Het
Gng11 G A 6: 4,008,078 R47H probably benign Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il18r1 A G 1: 40,495,788 E381G probably benign Het
Il9 G A 13: 56,479,451 T116I probably damaging Het
Kcnh1 A G 1: 192,238,799 T129A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Ntsr1 T C 2: 180,542,706 F401L probably benign Het
Nup210 A T 6: 91,020,180 D1626E probably benign Het
Olfr1277 A G 2: 111,270,226 V47A probably benign Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Olfr943 A G 9: 39,185,065 R293G probably damaging Het
Pign A G 1: 105,649,281 probably null Het
Rad54l2 A G 9: 106,693,527 V1198A probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Slc40a1 G T 1: 45,910,991 H434N probably benign Het
Trdv2-1 T C 14: 53,946,538 Y76H probably benign Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Zc3hav1l G T 6: 38,295,125 S236R probably damaging Het
Other mutations in Abra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01512:Abra APN 15 41866017 missense probably damaging 0.99
IGL02022:Abra APN 15 41869406 missense probably benign
IGL02370:Abra APN 15 41869244 missense probably damaging 1.00
IGL02406:Abra APN 15 41869187 missense probably damaging 1.00
R1860:Abra UTSW 15 41869034 missense probably damaging 1.00
R1861:Abra UTSW 15 41869034 missense probably damaging 1.00
R2385:Abra UTSW 15 41869353 missense probably damaging 0.97
R4582:Abra UTSW 15 41869285 missense probably benign 0.16
R4621:Abra UTSW 15 41869224 missense probably benign 0.10
R4724:Abra UTSW 15 41865906 missense probably damaging 1.00
R5926:Abra UTSW 15 41866254 missense probably damaging 1.00
R6417:Abra UTSW 15 41866056 missense probably benign 0.01
R6649:Abra UTSW 15 41869233 missense probably benign
R7348:Abra UTSW 15 41866159 missense probably damaging 1.00
R7487:Abra UTSW 15 41869553 missense probably damaging 1.00
R7997:Abra UTSW 15 41866197 missense probably damaging 1.00
RF053:Abra UTSW 15 41866299 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ATAGATGTGCTCTTCCGCTC -3'
(R):5'- GCTTGAGTTTAATATCACTAGTGGC -3'

Sequencing Primer
(F):5'- GCTCGCTTGGCCCTTTCAG -3'
(R):5'- CAGAGACTACACATGGGA -3'
Posted On2015-01-23