Incidental Mutation 'R0328:Ogdh'
ID25880
Institutional Source Beutler Lab
Gene Symbol Ogdh
Ensembl Gene ENSMUSG00000020456
Gene Nameoxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Synonyms2210403E04Rik, alpha-ketoglutarate dehydrogenase, d1401, 2210412K19Rik
MMRRC Submission 038537-MU
Accession Numbers

Genbank: NM_010956; MGI: 1098267; Ensembl: ENSMUST00000093350

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0328 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location6291633-6356642 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6347216 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 545 (V545A)
Ref Sequence ENSEMBL: ENSMUSP00000099090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003461] [ENSMUST00000081894] [ENSMUST00000093350] [ENSMUST00000101554]
Predicted Effect probably benign
Transcript: ENSMUST00000003461
AA Change: V545A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000003461
Gene: ENSMUSG00000020456
AA Change: V545A

DomainStartEndE-ValueType
Blast:Transket_pyr 131 199 8e-13 BLAST
Pfam:E1_dh 256 582 1.4e-95 PFAM
Transket_pyr 651 865 3.44e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000081894
AA Change: V541A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000080569
Gene: ENSMUSG00000020456
AA Change: V541A

DomainStartEndE-ValueType
Pfam:E1_dh 252 578 1e-96 PFAM
Transket_pyr 647 861 3.44e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093350
AA Change: V556A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091041
Gene: ENSMUSG00000020456
AA Change: V556A

DomainStartEndE-ValueType
Pfam:2-oxogl_dehyd_N 47 87 6.6e-21 PFAM
Pfam:E1_dh 267 593 1.1e-101 PFAM
Transket_pyr 662 876 3.44e-50 SMART
Pfam:OxoGdeHyase_C 880 1025 8.7e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101554
AA Change: V545A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000099090
Gene: ENSMUSG00000020456
AA Change: V545A

DomainStartEndE-ValueType
Blast:Transket_pyr 131 199 8e-13 BLAST
Pfam:E1_dh 256 582 1.4e-95 PFAM
Transket_pyr 651 865 3.44e-50 SMART
Meta Mutation Damage Score 0.1496 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.5%
  • 20x: 90.8%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one subunit of the 2-oxoglutarate dehydrogenase complex. This complex catalyzes the overall conversion of 2-oxoglutarate (alpha-ketoglutarate) to succinyl-CoA and CO(2) during the Krebs cycle. The protein is located in the mitochondrial matrix and uses thiamine pyrophosphate as a cofactor. A congenital deficiency in 2-oxoglutarate dehydrogenase activity is believed to lead to hypotonia, metabolic acidosis, and hyperlactatemia. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
Allele List at MGI

All alleles(34) : Gene trapped(34)

Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,744,280 H618L possibly damaging Het
Aacs T C 5: 125,516,259 V642A probably benign Het
Alms1 A G 6: 85,610,814 probably null Het
Arhgap39 A G 15: 76,751,952 probably benign Het
Bard1 C T 1: 71,046,762 V595I probably benign Het
Bptf T C 11: 107,047,127 K2713E probably damaging Het
Calhm1 C T 19: 47,141,303 G260D possibly damaging Het
Ccdc154 A C 17: 25,171,805 K643T probably benign Het
Ccl4 T A 11: 83,663,557 S59T probably damaging Het
Cntd1 T C 11: 101,283,433 S73P probably benign Het
Colgalt2 A T 1: 152,473,108 D168V probably damaging Het
Fam117a T C 11: 95,375,626 probably benign Het
Fat1 A G 8: 45,023,790 T1935A probably benign Het
Fbxw21 T A 9: 109,146,585 I248F possibly damaging Het
Fhod3 A T 18: 25,113,600 M1288L probably benign Het
Gm5114 T G 7: 39,408,461 K578T probably damaging Het
Gxylt2 A T 6: 100,750,535 probably benign Het
Helz G T 11: 107,604,348 A383S probably benign Het
Ift172 C A 5: 31,263,851 E968* probably null Het
Itpripl1 T C 2: 127,142,004 N66S possibly damaging Het
Kcnma1 A G 14: 23,373,197 Y686H probably damaging Het
Ndrg1 C A 15: 66,943,159 probably benign Het
Olfr121 A G 17: 37,752,393 I180V possibly damaging Het
P3h3 G A 6: 124,854,306 probably benign Het
Ppme1 A T 7: 100,333,975 probably null Het
Prkag1 T G 15: 98,815,682 D44A probably damaging Het
Prpf39 T C 12: 65,043,371 probably benign Het
Rabep1 C A 11: 70,919,207 R489S probably damaging Het
Scn10a A G 9: 119,694,102 V75A possibly damaging Het
Sema3d T C 5: 12,448,075 L16P possibly damaging Het
Skida1 T C 2: 18,047,186 probably benign Het
Sptbn4 T C 7: 27,364,170 Y2277C probably damaging Het
Syne1 A G 10: 5,348,945 I1047T possibly damaging Het
Syt17 A G 7: 118,381,993 Y369H probably benign Het
Tmem131l C T 3: 83,921,931 probably benign Het
Traf3ip2 A T 10: 39,634,673 D314V probably damaging Het
Ttc28 T G 5: 111,284,067 probably benign Het
Ush1c A C 7: 46,225,448 probably benign Het
Utp20 A T 10: 88,767,107 Y1884N possibly damaging Het
Vmn2r112 T A 17: 22,605,270 I502K probably benign Het
Vmn2r60 T C 7: 42,142,320 probably benign Het
Vmn2r63 T C 7: 42,903,275 I852M probably benign Het
Vmn2r9 T A 5: 108,847,539 E414D probably benign Het
Wnt4 A G 4: 137,295,443 T106A probably damaging Het
Zbtb26 A T 2: 37,436,795 N76K possibly damaging Het
Zfhx2 T C 14: 55,071,988 T885A probably benign Het
Other mutations in Ogdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ogdh APN 11 6348790 missense probably damaging 1.00
IGL01503:Ogdh APN 11 6355069 missense probably damaging 1.00
IGL01684:Ogdh APN 11 6342546 missense probably damaging 1.00
IGL02141:Ogdh APN 11 6355015 missense probably damaging 1.00
IGL02313:Ogdh APN 11 6355400 missense probably damaging 0.98
IGL02818:Ogdh APN 11 6348270 missense probably benign
N/A - 535:Ogdh UTSW 11 6324911 missense possibly damaging 0.60
PIT4498001:Ogdh UTSW 11 6340504 missense probably benign 0.09
R0505:Ogdh UTSW 11 6339936 splice site probably benign
R0627:Ogdh UTSW 11 6347216 missense possibly damaging 0.78
R1119:Ogdh UTSW 11 6340544 missense probably damaging 1.00
R1480:Ogdh UTSW 11 6347827 critical splice acceptor site probably null
R1591:Ogdh UTSW 11 6349384 missense probably damaging 1.00
R1804:Ogdh UTSW 11 6338565 missense probably damaging 1.00
R1873:Ogdh UTSW 11 6340438 splice site probably benign
R1959:Ogdh UTSW 11 6346638 missense possibly damaging 0.49
R2004:Ogdh UTSW 11 6334626 missense possibly damaging 0.90
R2080:Ogdh UTSW 11 6349393 missense probably benign 0.00
R2384:Ogdh UTSW 11 6342526 missense probably damaging 1.00
R2656:Ogdh UTSW 11 6348678 missense probably benign
R2883:Ogdh UTSW 11 6334545 missense probably damaging 1.00
R3405:Ogdh UTSW 11 6349462 missense probably damaging 1.00
R3838:Ogdh UTSW 11 6338627 nonsense probably null
R3933:Ogdh UTSW 11 6342601 missense possibly damaging 0.72
R3939:Ogdh UTSW 11 6350655 nonsense probably null
R4296:Ogdh UTSW 11 6349374 missense probably damaging 0.97
R4393:Ogdh UTSW 11 6316772 missense probably damaging 1.00
R4427:Ogdh UTSW 11 6355421 missense probably benign 0.01
R4667:Ogdh UTSW 11 6340600 missense probably benign 0.20
R4669:Ogdh UTSW 11 6340600 missense probably benign 0.20
R4728:Ogdh UTSW 11 6342549 missense probably damaging 1.00
R4737:Ogdh UTSW 11 6297044 missense probably benign
R4785:Ogdh UTSW 11 6349875 missense probably damaging 1.00
R4796:Ogdh UTSW 11 6340570 missense probably benign 0.01
R5333:Ogdh UTSW 11 6352126 missense probably damaging 1.00
R5592:Ogdh UTSW 11 6316763 intron probably null
R6318:Ogdh UTSW 11 6349390 missense probably damaging 0.99
R6875:Ogdh UTSW 11 6340477 missense probably benign 0.12
R6988:Ogdh UTSW 11 6313806 nonsense probably null
R7406:Ogdh UTSW 11 6348351 missense probably benign 0.00
R7724:Ogdh UTSW 11 6324887 missense probably benign
R7763:Ogdh UTSW 11 6338558 missense probably benign
R7909:Ogdh UTSW 11 6313965 missense possibly damaging 0.55
R8207:Ogdh UTSW 11 6349329 missense probably benign 0.38
Z1088:Ogdh UTSW 11 6355427 missense probably benign
Z1177:Ogdh UTSW 11 6297051 missense probably benign
Z1177:Ogdh UTSW 11 6316982 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCGAGTAGTGACAGCCTTGTTGTATC -3'
(R):5'- ACATCTGTATTGCCAGTCTCCAACAC -3'

Sequencing Primer
(F):5'- GACAGCCTTGTTGTATCACACAG -3'
(R):5'- CATGGGTCTAGAACTGCTACTCAG -3'
Posted On2013-04-16