Incidental Mutation 'R3718:Alas2'
ID258806
Institutional Source Beutler Lab
Gene Symbol Alas2
Ensembl Gene ENSMUSG00000025270
Gene Nameaminolevulinic acid synthase 2, erythroid
Synonyms5-aminolevulinate synthase, ALAS-E, ALASE, ALAS, erythroid-specific ALAS, Alas-2
MMRRC Submission 040710-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3718 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location150547375-150570638 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 150560730 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000108347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066337] [ENSMUST00000112715] [ENSMUST00000112725] [ENSMUST00000112727]
Predicted Effect probably benign
Transcript: ENSMUST00000066337
SMART Domains Protein: ENSMUSP00000066040
Gene: ENSMUSG00000025270

DomainStartEndE-ValueType
Pfam:Preseq_ALAS 49 100 1.4e-10 PFAM
Pfam:Aminotran_1_2 189 536 5.4e-78 PFAM
Pfam:Aminotran_5 203 367 2.4e-10 PFAM
Pfam:Cys_Met_Meta_PP 226 368 1.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112715
SMART Domains Protein: ENSMUSP00000108335
Gene: ENSMUSG00000025270

DomainStartEndE-ValueType
Pfam:Preseq_ALAS 1 86 4.7e-30 PFAM
Pfam:Aminotran_1_2 174 521 3e-78 PFAM
Pfam:Aminotran_5 188 352 1.1e-11 PFAM
Pfam:Cys_Met_Meta_PP 212 354 1.9e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112725
SMART Domains Protein: ENSMUSP00000108345
Gene: ENSMUSG00000025269

DomainStartEndE-ValueType
Pfam:Exo_endo_phos 5 258 1.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112727
SMART Domains Protein: ENSMUSP00000108347
Gene: ENSMUSG00000025269

DomainStartEndE-ValueType
Pfam:Exo_endo_phos 5 260 6.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134670
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene specifies an erythroid-specific mitochondrially located enzyme. The encoded protein catalyzes the first step in the heme biosynthetic pathway. Defects in this gene cause X-linked pyridoxine-responsive sideroblastic anemia. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality and severe anemia due to arrest of fetal hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abra T C 15: 41,866,293 D237G probably benign Het
Ano6 A G 15: 95,913,379 D120G probably damaging Het
Aspm T C 1: 139,480,889 Y2505H probably benign Het
Aspm G A 1: 139,490,427 V2965I probably benign Het
Ccna2 A T 3: 36,566,238 V285E probably benign Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dnajc10 A G 2: 80,324,745 probably benign Het
Dpp3 A G 19: 4,923,065 probably null Het
Gng11 G A 6: 4,008,078 R47H probably benign Het
Hivep1 C T 13: 42,158,495 H1404Y probably damaging Het
Il18r1 A G 1: 40,495,788 E381G probably benign Het
Il9 G A 13: 56,479,451 T116I probably damaging Het
Kcnh1 A G 1: 192,238,799 T129A probably damaging Het
Mroh7 T C 4: 106,704,210 E612G probably benign Het
Nav1 A T 1: 135,450,630 I1653K probably damaging Het
Neb T C 2: 52,277,470 E1948G probably damaging Het
Ntsr1 T C 2: 180,542,706 F401L probably benign Het
Nup210 A T 6: 91,020,180 D1626E probably benign Het
Olfr1277 A G 2: 111,270,226 V47A probably benign Het
Olfr1495 A G 19: 13,769,064 R241G probably damaging Het
Olfr943 A G 9: 39,185,065 R293G probably damaging Het
Pign A G 1: 105,649,281 probably null Het
Rad54l2 A G 9: 106,693,527 V1198A probably benign Het
Sh3tc2 T C 18: 61,990,343 V725A probably benign Het
Skint10 A T 4: 112,746,739 W84R probably damaging Het
Slc40a1 G T 1: 45,910,991 H434N probably benign Het
Trdv2-1 T C 14: 53,946,538 Y76H probably benign Het
Trim43c T C 9: 88,844,977 S286P probably benign Het
Ttn G A 2: 76,745,214 P25112S probably damaging Het
Ubac1 C T 2: 26,014,941 R95H probably damaging Het
Vps13d A G 4: 145,075,726 I405T probably damaging Het
Zc3hav1l G T 6: 38,295,125 S236R probably damaging Het
Other mutations in Alas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03227:Alas2 APN X 150557266 missense probably damaging 1.00
R3717:Alas2 UTSW X 150560730 intron probably benign
Predicted Primers PCR Primer
(F):5'- GGGAAACTGAATTTCTCCTCCC -3'
(R):5'- TGGAATGAACAGTCTCAAAAGCC -3'

Sequencing Primer
(F):5'- ACAGCAGTTAGGCATCCTTG -3'
(R):5'- AAAGCCACAATTTTTGGTGTCTTGG -3'
Posted On2015-01-23