Incidental Mutation 'R3719:Olfr1154'
ID258808
Institutional Source Beutler Lab
Gene Symbol Olfr1154
Ensembl Gene ENSMUSG00000075146
Gene Nameolfactory receptor 1154
SynonymsGA_x6K02T2Q125-49403456-49402524, MOR173-2
MMRRC Submission 042001-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R3719 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87901256-87905166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87903103 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 191 (T191I)
Ref Sequence ENSEMBL: ENSMUSP00000148909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099844] [ENSMUST00000215017] [ENSMUST00000215862] [ENSMUST00000217436]
Predicted Effect probably benign
Transcript: ENSMUST00000099844
AA Change: T191I

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097432
Gene: ENSMUSG00000075146
AA Change: T191I

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 8.1e-47 PFAM
Pfam:7tm_1 41 289 3.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215017
AA Change: T191I

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000215862
AA Change: T191I

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000217436
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 G A 15: 94,361,838 R327C probably damaging Het
Atxn2l G A 7: 126,498,130 R335W probably damaging Het
Blk A G 14: 63,384,002 S93P probably damaging Het
Cdk11b A G 4: 155,626,886 D75G probably damaging Het
Chpf2 C T 5: 24,590,312 Q278* probably null Het
Cypt14 C T X: 39,863,251 G52E probably damaging Het
Defb18 A G 1: 18,236,589 S48P possibly damaging Het
Dync2h1 A G 9: 7,006,882 probably benign Het
Ero1lb T G 13: 12,583,612 probably null Het
Gcn1l1 T C 5: 115,579,817 S254P probably benign Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Kdm3b C T 18: 34,808,671 A405V probably damaging Het
Mcm7 G A 5: 138,166,714 Q550* probably null Het
Pcdh7 A G 5: 58,129,032 E1150G probably damaging Het
Pcdhac2 A G 18: 37,146,235 Y756C possibly damaging Het
Pclo A G 5: 14,521,161 T187A probably benign Het
Rbms3 C T 9: 116,582,862 V421I probably benign Het
Selenbp2 T C 3: 94,699,617 F190S probably damaging Het
Sema6a G A 18: 47,249,077 T801M probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Spen G T 4: 141,517,183 H180Q unknown Het
Tenm4 A G 7: 96,863,563 K1339R possibly damaging Het
Trim30a C A 7: 104,411,163 D469Y probably benign Het
Trpm3 G A 19: 22,986,990 R1283H possibly damaging Het
Trpm6 A T 19: 18,772,393 R29* probably null Het
Ttc17 A G 2: 94,364,327 V567A probably benign Het
Vmn2r101 A G 17: 19,589,549 Y199C possibly damaging Het
Vmn2r73 A T 7: 85,870,374 Y459N probably damaging Het
Vmn2r79 A G 7: 87,002,037 I215V probably benign Het
Wdr48 C T 9: 119,907,131 S162F probably damaging Het
Other mutations in Olfr1154
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Olfr1154 APN 2 87903527 missense probably benign 0.00
IGL01878:Olfr1154 APN 2 87903331 nonsense probably null
IGL02683:Olfr1154 APN 2 87903104 missense possibly damaging 0.80
IGL02836:Olfr1154 APN 2 87903380 missense possibly damaging 0.81
R0432:Olfr1154 UTSW 2 87902960 missense probably damaging 1.00
R1123:Olfr1154 UTSW 2 87902904 missense probably damaging 0.99
R1223:Olfr1154 UTSW 2 87902819 missense probably damaging 0.99
R1561:Olfr1154 UTSW 2 87903161 missense probably benign 0.00
R1964:Olfr1154 UTSW 2 87903667 missense probably benign 0.00
R2041:Olfr1154 UTSW 2 87902797 missense probably damaging 1.00
R2219:Olfr1154 UTSW 2 87902925 nonsense probably null
R2233:Olfr1154 UTSW 2 87903475 missense probably damaging 1.00
R4826:Olfr1154 UTSW 2 87903349 missense probably damaging 1.00
R4908:Olfr1154 UTSW 2 87903189 missense probably damaging 1.00
R5056:Olfr1154 UTSW 2 87903571 missense probably damaging 1.00
R5589:Olfr1154 UTSW 2 87903347 missense probably benign 0.26
R6477:Olfr1154 UTSW 2 87902990 missense probably damaging 1.00
R6532:Olfr1154 UTSW 2 87903202 missense probably damaging 1.00
R6666:Olfr1154 UTSW 2 87903508 missense probably damaging 1.00
R6693:Olfr1154 UTSW 2 87903308 missense probably damaging 1.00
R6724:Olfr1154 UTSW 2 87903602 missense probably benign 0.00
R7784:Olfr1154 UTSW 2 87903193 missense probably benign 0.01
R8099:Olfr1154 UTSW 2 87903508 missense probably damaging 1.00
R8168:Olfr1154 UTSW 2 87903199 missense probably damaging 0.97
Z1088:Olfr1154 UTSW 2 87903584 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TAACTACTGTCAGGTGAGAAGCAC -3'
(R):5'- TTGGCTGCCATGGCTTATGAC -3'

Sequencing Primer
(F):5'- GCACAAGTAGAGAACCCTTTCTTTC -3'
(R):5'- CCATGGCTTATGACAGGTACATTGC -3'
Posted On2015-01-23