Mutagenetix > Incidental Mutation

Incidental Mutation 'R3719:Ttc17'

258809

Institutional Source

Beutler Lab

Gene Symbol

Ttc17

Ensembl Gene

ENSMUSG00000027194

Gene Name

tetratricopeptide repeat domain 17

Synonyms

D2Bwg1005e, 9130020K17Rik

MMRRC Submission

042001-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.575) question?

Stock #

R3719 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94300767-94406689 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 94364327 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 567 (V567A)

Ref Sequence

ENSEMBL: ENSMUSP00000092395 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055081] [ENSMUST00000094801] [ENSMUST00000111237] [ENSMUST00000111238]

AlphaFold

E9PVB5

Predicted Effect

probably benign
Transcript: ENSMUST00000055081

SMART Domains

Protein: ENSMUSP00000061360
Gene: ENSMUSG00000027194

Domain	Start	End	E-Value	Type
TPR	46	79	1.33e1	SMART
Blast:TPR	82	115	3e-10	BLAST
TPR	116	149	4.91e-4	SMART
low complexity region	326	344	N/A	INTRINSIC
TPR	499	532	2.43e1	SMART
TPR	535	568	6.75e1	SMART
TPR	569	602	6.84e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000094801
AA Change: V567A

PolyPhen 2 Score 0.267 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000092395
Gene: ENSMUSG00000027194
AA Change: V567A

Domain	Start	End	E-Value	Type
low complexity region	22	38	N/A	INTRINSIC
internal_repeat_1	113	271	7.26e-16	PROSPERO
low complexity region	275	293	N/A	INTRINSIC
TPR	295	328	1.39e-3	SMART
coiled coil region	340	382	N/A	INTRINSIC
TPR	619	652	1.33e1	SMART
Blast:TPR	655	688	3e-10	BLAST
TPR	689	722	4.91e-4	SMART
low complexity region	899	917	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111237
AA Change: V567A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000106868
Gene: ENSMUSG00000027194
AA Change: V567A

Domain	Start	End	E-Value	Type
low complexity region	22	38	N/A	INTRINSIC
Blast:TPR	225	258	8e-11	BLAST
low complexity region	275	293	N/A	INTRINSIC
TPR	295	328	1.39e-3	SMART
TPR	619	652	1.33e1	SMART
Blast:TPR	655	688	4e-10	BLAST
TPR	689	722	4.91e-4	SMART
low complexity region	842	860	N/A	INTRINSIC
TPR	1015	1048	2.43e1	SMART
TPR	1051	1084	6.75e1	SMART
TPR	1085	1118	6.84e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111238
AA Change: V567A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000106869
Gene: ENSMUSG00000027194
AA Change: V567A

Domain	Start	End	E-Value	Type
low complexity region	22	38	N/A	INTRINSIC
internal_repeat_2	113	271	8.31e-15	PROSPERO
low complexity region	275	293	N/A	INTRINSIC
TPR	295	328	1.39e-3	SMART
coiled coil region	340	382	N/A	INTRINSIC
TPR	619	652	1.33e1	SMART
Blast:TPR	655	688	4e-10	BLAST
TPR	689	722	4.91e-4	SMART
low complexity region	899	917	N/A	INTRINSIC
TPR	1072	1105	2.43e1	SMART
TPR	1108	1141	6.75e1	SMART
TPR	1142	1175	6.84e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150215

Meta Mutation Damage Score

0.0593

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.7%

Validation Efficiency

97% (35/36)

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts20	G	A	15: 94,361,838	R327C	probably damaging	Het
Atxn2l	G	A	7: 126,498,130	R335W	probably damaging	Het
Blk	A	G	14: 63,384,002	S93P	probably damaging	Het
Cdk11b	A	G	4: 155,626,886	D75G	probably damaging	Het
Chpf2	C	T	5: 24,590,312	Q278*	probably null	Het
Cypt14	C	T	X: 39,863,251	G52E	probably damaging	Het
Defb18	A	G	1: 18,236,589	S48P	possibly damaging	Het
Dync2h1	A	G	9: 7,006,882		probably benign	Het
Ero1lb	T	G	13: 12,583,612		probably null	Het
Gcn1l1	T	C	5: 115,579,817	S254P	probably benign	Het
Hivep1	T	C	13: 42,157,727	S1148P	probably benign	Het
Kdm3b	C	T	18: 34,808,671	A405V	probably damaging	Het
Mcm7	G	A	5: 138,166,714	Q550*	probably null	Het
Olfr1154	G	A	2: 87,903,103	T191I	probably benign	Het
Pcdh7	A	G	5: 58,129,032	E1150G	probably damaging	Het
Pcdhac2	A	G	18: 37,146,235	Y756C	possibly damaging	Het
Pclo	A	G	5: 14,521,161	T187A	probably benign	Het
Rbms3	C	T	9: 116,582,862	V421I	probably benign	Het
Selenbp2	T	C	3: 94,699,617	F190S	probably damaging	Het
Sema6a	G	A	18: 47,249,077	T801M	probably damaging	Het
Slc16a10	G	C	10: 40,056,624	H314D	possibly damaging	Het
Spen	G	T	4: 141,517,183	H180Q	unknown	Het
Tenm4	A	G	7: 96,863,563	K1339R	possibly damaging	Het
Trim30a	C	A	7: 104,411,163	D469Y	probably benign	Het
Trpm3	G	A	19: 22,986,990	R1283H	possibly damaging	Het
Trpm6	A	T	19: 18,772,393	R29*	probably null	Het
Vmn2r101	A	G	17: 19,589,549	Y199C	possibly damaging	Het
Vmn2r73	A	T	7: 85,870,374	Y459N	probably damaging	Het
Vmn2r79	A	G	7: 87,002,037	I215V	probably benign	Het
Wdr48	C	T	9: 119,907,131	S162F	probably damaging	Het

Other mutations in Ttc17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Ttc17	APN	2	94323083	splice site	probably benign
IGL00870:Ttc17	APN	2	94371733	splice site	probably null
IGL01120:Ttc17	APN	2	94371796	missense	probably damaging	1.00
IGL01845:Ttc17	APN	2	94332832	nonsense	probably null
IGL01895:Ttc17	APN	2	94375146	missense	possibly damaging	0.80
IGL02064:Ttc17	APN	2	94330667	missense	probably damaging	1.00
IGL02296:Ttc17	APN	2	94377710	missense	probably damaging	1.00
IGL02309:Ttc17	APN	2	94342661	missense	probably benign
IGL02456:Ttc17	APN	2	94362785	splice site	probably benign
IGL02475:Ttc17	APN	2	94364376	missense	probably damaging	1.00
IGL03341:Ttc17	APN	2	94375221	missense	probably damaging	1.00
IGL03371:Ttc17	APN	2	94386105	missense	probably damaging	1.00
R0389:Ttc17	UTSW	2	94378094	missense	probably benign	0.03
R0443:Ttc17	UTSW	2	94378094	missense	probably benign	0.03
R0511:Ttc17	UTSW	2	94323120	missense	possibly damaging	0.87
R0763:Ttc17	UTSW	2	94332803	missense	probably benign	0.08
R1980:Ttc17	UTSW	2	94326704	missense	probably benign	0.14
R1981:Ttc17	UTSW	2	94326704	missense	probably benign	0.14
R1987:Ttc17	UTSW	2	94364345	missense	probably benign
R2064:Ttc17	UTSW	2	94366547	missense	probably damaging	1.00
R2147:Ttc17	UTSW	2	94301794	missense	possibly damaging	0.87
R2155:Ttc17	UTSW	2	94366642	missense	possibly damaging	0.88
R2844:Ttc17	UTSW	2	94376074	nonsense	probably null
R3852:Ttc17	UTSW	2	94369413	missense	possibly damaging	0.86
R3947:Ttc17	UTSW	2	94376146	splice site	probably benign
R4411:Ttc17	UTSW	2	94342753	missense	probably damaging	0.97
R4461:Ttc17	UTSW	2	94366571	missense	probably benign	0.02
R4660:Ttc17	UTSW	2	94364429	missense	possibly damaging	0.51
R4762:Ttc17	UTSW	2	94371768	missense	probably damaging	1.00
R4818:Ttc17	UTSW	2	94332891	missense	possibly damaging	0.91
R4819:Ttc17	UTSW	2	94364610	missense	probably damaging	1.00
R4864:Ttc17	UTSW	2	94366635	missense	probably benign	0.01
R4870:Ttc17	UTSW	2	94366609	missense	probably damaging	1.00
R5203:Ttc17	UTSW	2	94378716	missense	probably damaging	1.00
R5288:Ttc17	UTSW	2	94303640	missense	probably damaging	1.00
R5385:Ttc17	UTSW	2	94303640	missense	probably damaging	1.00
R5386:Ttc17	UTSW	2	94303640	missense	probably damaging	1.00
R5453:Ttc17	UTSW	2	94303560	missense	probably damaging	1.00
R5583:Ttc17	UTSW	2	94377682	missense	probably damaging	1.00
R5683:Ttc17	UTSW	2	94362521	missense	probably damaging	1.00
R5921:Ttc17	UTSW	2	94378848	missense	probably damaging	1.00
R6272:Ttc17	UTSW	2	94358755	missense	probably damaging	1.00
R6444:Ttc17	UTSW	2	94303546	missense	possibly damaging	0.57
R6748:Ttc17	UTSW	2	94386102	missense	probably benign	0.02
R7204:Ttc17	UTSW	2	94362428	missense	possibly damaging	0.95
R7300:Ttc17	UTSW	2	94375134	missense	probably damaging	1.00
R7446:Ttc17	UTSW	2	94375150	missense	probably damaging	0.97
R7680:Ttc17	UTSW	2	94366544	missense	probably benign	0.06
R7912:Ttc17	UTSW	2	94378821	missense	probably damaging	1.00
R8083:Ttc17	UTSW	2	94374564	missense	probably damaging	1.00
R8304:Ttc17	UTSW	2	94369181	intron	probably benign
R8381:Ttc17	UTSW	2	94301821	missense	probably damaging	1.00
R8512:Ttc17	UTSW	2	94371763	missense	probably damaging	1.00
R8737:Ttc17	UTSW	2	94376029	critical splice donor site	probably null
R8850:Ttc17	UTSW	2	94406658	missense	possibly damaging	0.55
R8886:Ttc17	UTSW	2	94375128	missense	probably benign	0.19
R8888:Ttc17	UTSW	2	94326704	missense	probably benign	0.14
R8891:Ttc17	UTSW	2	94362419	missense	probably damaging	1.00
R9336:Ttc17	UTSW	2	94358853	missense	probably benign	0.00
R9600:Ttc17	UTSW	2	94374545	missense	probably damaging	1.00
R9632:Ttc17	UTSW	2	94378752	missense	probably damaging	1.00
R9642:Ttc17	UTSW	2	94364390	missense	probably benign	0.00
R9657:Ttc17	UTSW	2	94406665	start codon destroyed	probably benign	0.02
X0013:Ttc17	UTSW	2	94330670	missense	probably damaging	1.00
X0018:Ttc17	UTSW	2	94378716	missense	probably damaging	1.00
X0025:Ttc17	UTSW	2	94324516	missense	possibly damaging	0.86

Predicted Primers

PCR Primer
(F):5'- TGATGAGAAGCGTGGCTGAC -3'
(R):5'- GCCTTGGACTTGAAAGGTTAAG -3'

Sequencing Primer
(F):5'- TGAGAAGCGTGGCTGACATCTC -3'
(R):5'- GGTTAAGTCTTTGTCTTGAACTCAC -3'

Posted On

2015-01-23