Incidental Mutation 'R3719:Selenbp2'
ID258810
Institutional Source Beutler Lab
Gene Symbol Selenbp2
Ensembl Gene ENSMUSG00000068877
Gene Nameselenium binding protein 2
SynonymsAP56, Lpsb2, acetaminophen-binding protein
MMRRC Submission 042001-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R3719 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location94693556-94704413 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94699617 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 190 (F190S)
Ref Sequence ENSEMBL: ENSMUSP00000088358 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090848] [ENSMUST00000131650] [ENSMUST00000173849] [ENSMUST00000173981] [ENSMUST00000174223]
Predicted Effect probably damaging
Transcript: ENSMUST00000090848
AA Change: F190S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088358
Gene: ENSMUSG00000068877
AA Change: F190S

DomainStartEndE-ValueType
Pfam:SBP56 6 472 7.8e-227 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131650
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132162
Predicted Effect probably damaging
Transcript: ENSMUST00000173849
AA Change: F128S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000134270
Gene: ENSMUSG00000068877
AA Change: F128S

DomainStartEndE-ValueType
Pfam:SBP56 6 62 4.4e-22 PFAM
Pfam:SBP56 57 410 4.1e-165 PFAM
Pfam:Lactonase 163 296 4.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173981
SMART Domains Protein: ENSMUSP00000133320
Gene: ENSMUSG00000068877

DomainStartEndE-ValueType
Pfam:SBP56 1 128 3.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174223
SMART Domains Protein: ENSMUSP00000134623
Gene: ENSMUSG00000068877

DomainStartEndE-ValueType
Pfam:SBP56 6 134 3.1e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174377
Meta Mutation Damage Score 0.8967 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 G A 15: 94,361,838 R327C probably damaging Het
Atxn2l G A 7: 126,498,130 R335W probably damaging Het
Blk A G 14: 63,384,002 S93P probably damaging Het
Cdk11b A G 4: 155,626,886 D75G probably damaging Het
Chpf2 C T 5: 24,590,312 Q278* probably null Het
Cypt14 C T X: 39,863,251 G52E probably damaging Het
Defb18 A G 1: 18,236,589 S48P possibly damaging Het
Dync2h1 A G 9: 7,006,882 probably benign Het
Ero1lb T G 13: 12,583,612 probably null Het
Gcn1l1 T C 5: 115,579,817 S254P probably benign Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Kdm3b C T 18: 34,808,671 A405V probably damaging Het
Mcm7 G A 5: 138,166,714 Q550* probably null Het
Olfr1154 G A 2: 87,903,103 T191I probably benign Het
Pcdh7 A G 5: 58,129,032 E1150G probably damaging Het
Pcdhac2 A G 18: 37,146,235 Y756C possibly damaging Het
Pclo A G 5: 14,521,161 T187A probably benign Het
Rbms3 C T 9: 116,582,862 V421I probably benign Het
Sema6a G A 18: 47,249,077 T801M probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Spen G T 4: 141,517,183 H180Q unknown Het
Tenm4 A G 7: 96,863,563 K1339R possibly damaging Het
Trim30a C A 7: 104,411,163 D469Y probably benign Het
Trpm3 G A 19: 22,986,990 R1283H possibly damaging Het
Trpm6 A T 19: 18,772,393 R29* probably null Het
Ttc17 A G 2: 94,364,327 V567A probably benign Het
Vmn2r101 A G 17: 19,589,549 Y199C possibly damaging Het
Vmn2r73 A T 7: 85,870,374 Y459N probably damaging Het
Vmn2r79 A G 7: 87,002,037 I215V probably benign Het
Wdr48 C T 9: 119,907,131 S162F probably damaging Het
Other mutations in Selenbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01875:Selenbp2 APN 3 94698144 missense possibly damaging 0.76
IGL02007:Selenbp2 APN 3 94698154 missense possibly damaging 0.67
IGL02103:Selenbp2 APN 3 94698131 missense probably null
IGL02222:Selenbp2 APN 3 94699962 missense probably damaging 1.00
IGL02441:Selenbp2 APN 3 94704064 missense probably benign 0.02
IGL03086:Selenbp2 APN 3 94699638 missense probably damaging 1.00
R0068:Selenbp2 UTSW 3 94703509 missense probably benign 0.00
R0256:Selenbp2 UTSW 3 94699701 missense probably benign 0.35
R0725:Selenbp2 UTSW 3 94697502 splice site probably benign
R0879:Selenbp2 UTSW 3 94699556 missense possibly damaging 0.76
R1636:Selenbp2 UTSW 3 94696815 missense probably damaging 1.00
R4828:Selenbp2 UTSW 3 94704119 missense probably benign 0.27
R4962:Selenbp2 UTSW 3 94703549 missense probably damaging 0.99
R6661:Selenbp2 UTSW 3 94702514 missense probably damaging 1.00
R7201:Selenbp2 UTSW 3 94702357 missense probably benign 0.03
R7221:Selenbp2 UTSW 3 94703826 nonsense probably null
R7413:Selenbp2 UTSW 3 94700097 missense probably benign 0.03
X0050:Selenbp2 UTSW 3 94704128 missense probably damaging 0.99
Z1176:Selenbp2 UTSW 3 94698100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGTACAGAGTAAGGGCCTCC -3'
(R):5'- GCAAGACAAGTGCAGATCTG -3'

Sequencing Primer
(F):5'- GACTCCTGCCATCTCTAAAATGGATG -3'
(R):5'- ATCTGCTGTAGGGTAGAGAGC -3'
Posted On2015-01-23