Incidental Mutation 'R3719:Blk'
ID258829
Institutional Source Beutler Lab
Gene Symbol Blk
Ensembl Gene ENSMUSG00000014453
Gene NameB lymphoid kinase
Synonyms
MMRRC Submission 042001-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3719 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location63372836-63417037 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63384002 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 93 (S93P)
Ref Sequence ENSEMBL: ENSMUSP00000014597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014597]
PDB Structure
NMR ENSEMBLE OF BLK SH2 DOMAIN, 20 STRUCTURES [SOLUTION NMR]
NMR ENSEMBLE OF BLK SH2 DOMAIN USING CHEMICAL SHIFT REFINEMENT, 20 STRUCTURES [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000014597
AA Change: S93P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014597
Gene: ENSMUSG00000014453
AA Change: S93P

DomainStartEndE-ValueType
SH3 55 111 2.91e-18 SMART
SH2 116 205 1.32e-32 SMART
TyrKc 235 484 1.97e-127 SMART
Meta Mutation Damage Score 0.8538 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 97% (35/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nonreceptor tyrosine-kinase of the src family of proto-oncogenes that are typically involved in cell proliferation and differentiation. The protein has a role in B-cell receptor signaling and B-cell development. The protein also stimulates insulin synthesis and secretion in response to glucose and enhances the expression of several pancreatic beta-cell transcription factors. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygous mutation of this gene does not result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts20 G A 15: 94,361,838 R327C probably damaging Het
Atxn2l G A 7: 126,498,130 R335W probably damaging Het
Cdk11b A G 4: 155,626,886 D75G probably damaging Het
Chpf2 C T 5: 24,590,312 Q278* probably null Het
Cypt14 C T X: 39,863,251 G52E probably damaging Het
Defb18 A G 1: 18,236,589 S48P possibly damaging Het
Dync2h1 A G 9: 7,006,882 probably benign Het
Ero1lb T G 13: 12,583,612 probably null Het
Gcn1l1 T C 5: 115,579,817 S254P probably benign Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Kdm3b C T 18: 34,808,671 A405V probably damaging Het
Mcm7 G A 5: 138,166,714 Q550* probably null Het
Olfr1154 G A 2: 87,903,103 T191I probably benign Het
Pcdh7 A G 5: 58,129,032 E1150G probably damaging Het
Pcdhac2 A G 18: 37,146,235 Y756C possibly damaging Het
Pclo A G 5: 14,521,161 T187A probably benign Het
Rbms3 C T 9: 116,582,862 V421I probably benign Het
Selenbp2 T C 3: 94,699,617 F190S probably damaging Het
Sema6a G A 18: 47,249,077 T801M probably damaging Het
Slc16a10 G C 10: 40,056,624 H314D possibly damaging Het
Spen G T 4: 141,517,183 H180Q unknown Het
Tenm4 A G 7: 96,863,563 K1339R possibly damaging Het
Trim30a C A 7: 104,411,163 D469Y probably benign Het
Trpm3 G A 19: 22,986,990 R1283H possibly damaging Het
Trpm6 A T 19: 18,772,393 R29* probably null Het
Ttc17 A G 2: 94,364,327 V567A probably benign Het
Vmn2r101 A G 17: 19,589,549 Y199C possibly damaging Het
Vmn2r73 A T 7: 85,870,374 Y459N probably damaging Het
Vmn2r79 A G 7: 87,002,037 I215V probably benign Het
Wdr48 C T 9: 119,907,131 S162F probably damaging Het
Other mutations in Blk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Blk APN 14 63380720 missense probably damaging 1.00
IGL02146:Blk APN 14 63374199 missense probably damaging 1.00
IGL02684:Blk APN 14 63379694 missense probably benign 0.17
blaenka UTSW 14 63384002 missense probably damaging 1.00
BB009:Blk UTSW 14 63373559 missense possibly damaging 0.67
BB019:Blk UTSW 14 63373559 missense possibly damaging 0.67
R0254:Blk UTSW 14 63380804 missense probably benign 0.08
R0318:Blk UTSW 14 63374197 missense probably damaging 1.00
R1567:Blk UTSW 14 63380729 missense probably damaging 0.99
R1871:Blk UTSW 14 63375915 missense possibly damaging 0.72
R4606:Blk UTSW 14 63374203 missense probably benign 0.00
R4879:Blk UTSW 14 63375965 missense probably benign
R4935:Blk UTSW 14 63381262 missense possibly damaging 0.95
R5014:Blk UTSW 14 63379787 missense probably benign 0.00
R5352:Blk UTSW 14 63375971 missense probably damaging 1.00
R5406:Blk UTSW 14 63380731 missense probably damaging 1.00
R5514:Blk UTSW 14 63378481 missense probably damaging 0.99
R5518:Blk UTSW 14 63378507 missense possibly damaging 0.56
R6289:Blk UTSW 14 63375892 splice site probably null
R6743:Blk UTSW 14 63384926 missense probably benign
R7932:Blk UTSW 14 63373559 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TCCCTTGGCATCATTCAGAG -3'
(R):5'- ACCTCCTTATCACCAGGCTG -3'

Sequencing Primer
(F):5'- GAGAGCCAGAACTTTCCATTCCTG -3'
(R):5'- ACCAGGCTGTCTGTCTGTC -3'
Posted On2015-01-23