Incidental Mutation 'R3720:Trak2'
ID258839
Institutional Source Beutler Lab
Gene Symbol Trak2
Ensembl Gene ENSMUSG00000026028
Gene Nametrafficking protein, kinesin binding 2
SynonymsGRIF-1, 4733401O11Rik, GRIF1, OIP98, CALS-C, 2900022D04Rik, Als2cr3
MMRRC Submission 040711-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3720 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58900449-58973430 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 58946245 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027186] [ENSMUST00000173590] [ENSMUST00000174120]
Predicted Effect probably null
Transcript: ENSMUST00000027186
SMART Domains Protein: ENSMUSP00000027186
Gene: ENSMUSG00000026028

DomainStartEndE-ValueType
Pfam:HAP1_N 48 353 2.5e-135 PFAM
Pfam:Milton 426 565 3e-26 PFAM
low complexity region 663 673 N/A INTRINSIC
low complexity region 693 714 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173590
SMART Domains Protein: ENSMUSP00000134499
Gene: ENSMUSG00000026028

DomainStartEndE-ValueType
Pfam:HAP1_N 2 52 9.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173719
Predicted Effect probably null
Transcript: ENSMUST00000174120
SMART Domains Protein: ENSMUSP00000134253
Gene: ENSMUSG00000026028

DomainStartEndE-ValueType
Pfam:HAP1_N 47 354 1.3e-129 PFAM
Pfam:Milton 411 565 1.1e-41 PFAM
Meta Mutation Damage Score 0.9496 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 93% (40/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Atp2c1 A T 9: 105,422,976 M708K probably damaging Het
C9 A G 15: 6,483,119 T241A possibly damaging Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cntnap5c T C 17: 58,330,202 S1025P probably benign Het
Col8a1 T C 16: 57,626,916 M744V unknown Het
Cstf3 A G 2: 104,653,086 probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Glt6d1 ACCC ACCCC 2: 25,795,167 probably null Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Hivep1 C T 13: 42,158,601 T1439I probably benign Het
Iqgap2 T C 13: 95,668,528 probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kif1c T C 11: 70,703,771 F86L possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ldb1 C T 19: 46,044,892 probably benign Het
Lrmda T A 14: 22,027,331 probably benign Het
Med23 T C 10: 24,891,120 L369S probably damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myo1b G T 1: 51,776,346 H614N possibly damaging Het
Neurl1b C T 17: 26,414,975 T4M probably damaging Het
Olfr1095 T C 2: 86,851,591 T36A probably benign Het
Olfr129 T C 17: 38,055,368 Y66C probably damaging Het
Polg G A 7: 79,456,791 Q163* probably null Het
Pramef8 A G 4: 143,419,379 T473A probably benign Het
Sdk2 G A 11: 113,800,244 P1835L probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Snx31 T C 15: 36,523,558 probably null Het
Speg A T 1: 75,426,782 H2590L probably damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Swap70 A G 7: 110,270,047 E349G probably damaging Het
Sybu A G 15: 44,672,632 V766A possibly damaging Het
Tns3 G A 11: 8,492,999 R455W probably damaging Het
Tnxb T A 17: 34,712,964 V2157E possibly damaging Het
Trav18 C T 14: 53,831,617 R39C possibly damaging Het
Uroc1 G A 6: 90,346,355 V352M probably damaging Het
Zfp106 A C 2: 120,534,599 I442M probably benign Het
Zfp935 G A 13: 62,455,032 Q98* probably null Het
Other mutations in Trak2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Trak2 APN 1 58923607 missense probably damaging 1.00
IGL01982:Trak2 APN 1 58926655 missense possibly damaging 0.94
IGL02154:Trak2 APN 1 58908729 missense probably damaging 1.00
IGL02399:Trak2 APN 1 58910045 missense probably benign 0.00
IGL02732:Trak2 APN 1 58910063 missense probably benign 0.19
IGL02734:Trak2 APN 1 58910063 missense probably benign 0.19
IGL03147:Trak2 UTSW 1 58910063 missense probably benign 0.19
P0041:Trak2 UTSW 1 58909964 missense probably damaging 1.00
R0079:Trak2 UTSW 1 58926724 missense probably damaging 1.00
R0791:Trak2 UTSW 1 58903661 missense probably benign
R0792:Trak2 UTSW 1 58903661 missense probably benign
R1099:Trak2 UTSW 1 58921841 missense probably benign 0.05
R1899:Trak2 UTSW 1 58946336 start codon destroyed probably null 0.98
R1903:Trak2 UTSW 1 58918855 splice site probably null
R2292:Trak2 UTSW 1 58935757 missense probably damaging 0.99
R2312:Trak2 UTSW 1 58935782 missense probably damaging 1.00
R4966:Trak2 UTSW 1 58919321 missense probably damaging 1.00
R5088:Trak2 UTSW 1 58935808 missense probably benign 0.06
R5730:Trak2 UTSW 1 58921807 missense probably damaging 1.00
R5840:Trak2 UTSW 1 58919273 missense probably damaging 1.00
R5981:Trak2 UTSW 1 58908690 missense probably benign 0.01
R6000:Trak2 UTSW 1 58911812 missense possibly damaging 0.71
R6053:Trak2 UTSW 1 58904069 missense possibly damaging 0.62
R6894:Trak2 UTSW 1 58911733 missense probably damaging 1.00
R6916:Trak2 UTSW 1 58910025 missense probably benign 0.06
R7096:Trak2 UTSW 1 58903590 missense probably damaging 1.00
R7544:Trak2 UTSW 1 58921068 splice site probably null
R7847:Trak2 UTSW 1 58935818 missense possibly damaging 0.88
R7889:Trak2 UTSW 1 58918824 missense probably damaging 1.00
R8039:Trak2 UTSW 1 58946288 missense probably benign 0.16
R8313:Trak2 UTSW 1 58921147 nonsense probably null
R8728:Trak2 UTSW 1 58935775 missense probably benign 0.01
X0067:Trak2 UTSW 1 58908532 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- CTGCACAGAAGGCAGACTTTG -3'
(R):5'- ATGTCACCTGACTCATCGCAG -3'

Sequencing Primer
(F):5'- ACTTTGCTAATGTGAGAGGAGAC -3'
(R):5'- GACCACGCCCATTTCTTTACTAAATG -3'
Posted On2015-01-23