Incidental Mutation 'R3720:Glt6d1'
ID258841
Institutional Source Beutler Lab
Gene Symbol Glt6d1
Ensembl Gene ENSMUSG00000036401
Gene Nameglycosyltransferase 6 domain containing 1
Synonyms4933411C14Rik
MMRRC Submission 040711-MU
Accession Numbers

Ncbi RefSeq: NM_001039095.1; MGI:1918353

Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R3720 (G1)
Quality Score195
Status Validated
Chromosome2
Chromosomal Location25793859-25815848 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) ACCC to ACCCC at 25795167 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038010]
Predicted Effect probably null
Transcript: ENSMUST00000038010
SMART Domains Protein: ENSMUSP00000048642
Gene: ENSMUSG00000036401

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
Pfam:Glyco_transf_6 22 310 6.8e-101 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130316
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143166
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The GT6 glycosyltransferases gene family, which includes the ABO blood group (ABO; MIM 110300) and GLT6D1, shows a complex evolution pattern, with multiple events of gain and loss in different mammal species. In humans, the ABO gene is considered the sole functional member, although the O allele is null and is fixed in certain populations (summary by Casals et al. (2009) [PubMed 19218399]).[supplied by OMIM, Jan 2011]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Atp2c1 A T 9: 105,422,976 M708K probably damaging Het
C9 A G 15: 6,483,119 T241A possibly damaging Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cntnap5c T C 17: 58,330,202 S1025P probably benign Het
Col8a1 T C 16: 57,626,916 M744V unknown Het
Cstf3 A G 2: 104,653,086 probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Hivep1 C T 13: 42,158,601 T1439I probably benign Het
Iqgap2 T C 13: 95,668,528 probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kif1c T C 11: 70,703,771 F86L possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ldb1 C T 19: 46,044,892 probably benign Het
Lrmda T A 14: 22,027,331 probably benign Het
Med23 T C 10: 24,891,120 L369S probably damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myo1b G T 1: 51,776,346 H614N possibly damaging Het
Neurl1b C T 17: 26,414,975 T4M probably damaging Het
Olfr1095 T C 2: 86,851,591 T36A probably benign Het
Olfr129 T C 17: 38,055,368 Y66C probably damaging Het
Polg G A 7: 79,456,791 Q163* probably null Het
Pramef8 A G 4: 143,419,379 T473A probably benign Het
Sdk2 G A 11: 113,800,244 P1835L probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Snx31 T C 15: 36,523,558 probably null Het
Speg A T 1: 75,426,782 H2590L probably damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Swap70 A G 7: 110,270,047 E349G probably damaging Het
Sybu A G 15: 44,672,632 V766A possibly damaging Het
Tns3 G A 11: 8,492,999 R455W probably damaging Het
Tnxb T A 17: 34,712,964 V2157E possibly damaging Het
Trak2 A T 1: 58,946,245 probably null Het
Trav18 C T 14: 53,831,617 R39C possibly damaging Het
Uroc1 G A 6: 90,346,355 V352M probably damaging Het
Zfp106 A C 2: 120,534,599 I442M probably benign Het
Zfp935 G A 13: 62,455,032 Q98* probably null Het
Other mutations in Glt6d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Glt6d1 APN 2 25811029 missense probably damaging 1.00
IGL01722:Glt6d1 APN 2 25794419 missense probably benign 0.02
IGL01734:Glt6d1 APN 2 25794493 missense probably benign 0.01
R0010:Glt6d1 UTSW 2 25794727 critical splice acceptor site probably null
R0010:Glt6d1 UTSW 2 25794727 critical splice acceptor site probably null
R0039:Glt6d1 UTSW 2 25794727 critical splice acceptor site probably null
R0079:Glt6d1 UTSW 2 25794727 critical splice acceptor site probably null
R0082:Glt6d1 UTSW 2 25794727 critical splice acceptor site probably null
R0197:Glt6d1 UTSW 2 25794070 missense probably benign
R0432:Glt6d1 UTSW 2 25794727 critical splice acceptor site probably null
R0525:Glt6d1 UTSW 2 25794268 missense possibly damaging 0.96
R1494:Glt6d1 UTSW 2 25794248 missense probably damaging 1.00
R1959:Glt6d1 UTSW 2 25794413 missense probably damaging 1.00
R4074:Glt6d1 UTSW 2 25794127 missense probably damaging 1.00
R5664:Glt6d1 UTSW 2 25814180 missense probably benign 0.03
R7075:Glt6d1 UTSW 2 25795280 missense probably benign 0.00
R7576:Glt6d1 UTSW 2 25814122 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- TGGCCTTATAGACCCAGCCTTG -3'
(R):5'- ATGCGGTGACACTCGACATG -3'

Sequencing Primer
(F):5'- TTATAGACCCAGCCTTGGTACAGG -3'
(R):5'- TGACACTCGACATGTAGCTG -3'
Posted On2015-01-23