Incidental Mutation 'R3720:Olfr1095'
ID258842
Institutional Source Beutler Lab
Gene Symbol Olfr1095
Ensembl Gene ENSMUSG00000075171
Gene Nameolfactory receptor 1095
SynonymsGA_x6K02T2Q125-48336843-48335917, MOR179-1
MMRRC Submission 040711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R3720 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86850770-86851696 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86851591 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 36 (T36A)
Ref Sequence ENSEMBL: ENSMUSP00000097459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099874]
Predicted Effect probably benign
Transcript: ENSMUST00000099874
AA Change: T36A

PolyPhen 2 Score 0.160 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097459
Gene: ENSMUSG00000075171
AA Change: T36A

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.7e-47 PFAM
Pfam:7tm_1 39 288 9.8e-21 PFAM
Meta Mutation Damage Score 0.1708 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Atp2c1 A T 9: 105,422,976 M708K probably damaging Het
C9 A G 15: 6,483,119 T241A possibly damaging Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cntnap5c T C 17: 58,330,202 S1025P probably benign Het
Col8a1 T C 16: 57,626,916 M744V unknown Het
Cstf3 A G 2: 104,653,086 probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Glt6d1 ACCC ACCCC 2: 25,795,167 probably null Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Hivep1 C T 13: 42,158,601 T1439I probably benign Het
Iqgap2 T C 13: 95,668,528 probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kif1c T C 11: 70,703,771 F86L possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ldb1 C T 19: 46,044,892 probably benign Het
Lrmda T A 14: 22,027,331 probably benign Het
Med23 T C 10: 24,891,120 L369S probably damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myo1b G T 1: 51,776,346 H614N possibly damaging Het
Neurl1b C T 17: 26,414,975 T4M probably damaging Het
Olfr129 T C 17: 38,055,368 Y66C probably damaging Het
Polg G A 7: 79,456,791 Q163* probably null Het
Pramef8 A G 4: 143,419,379 T473A probably benign Het
Sdk2 G A 11: 113,800,244 P1835L probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Snx31 T C 15: 36,523,558 probably null Het
Speg A T 1: 75,426,782 H2590L probably damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Swap70 A G 7: 110,270,047 E349G probably damaging Het
Sybu A G 15: 44,672,632 V766A possibly damaging Het
Tns3 G A 11: 8,492,999 R455W probably damaging Het
Tnxb T A 17: 34,712,964 V2157E possibly damaging Het
Trak2 A T 1: 58,946,245 probably null Het
Trav18 C T 14: 53,831,617 R39C possibly damaging Het
Uroc1 G A 6: 90,346,355 V352M probably damaging Het
Zfp106 A C 2: 120,534,599 I442M probably benign Het
Zfp935 G A 13: 62,455,032 Q98* probably null Het
Other mutations in Olfr1095
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02010:Olfr1095 APN 2 86851197 missense possibly damaging 0.77
IGL02947:Olfr1095 APN 2 86850786 missense probably benign 0.00
IGL03106:Olfr1095 APN 2 86851614 missense possibly damaging 0.92
R0631:Olfr1095 UTSW 2 86850967 missense probably benign 0.07
R1640:Olfr1095 UTSW 2 86851227 missense probably benign 0.05
R1718:Olfr1095 UTSW 2 86851187 missense probably benign 0.22
R1936:Olfr1095 UTSW 2 86851401 missense probably benign 0.01
R4177:Olfr1095 UTSW 2 86851401 missense possibly damaging 0.56
R5378:Olfr1095 UTSW 2 86851463 missense probably benign
R5589:Olfr1095 UTSW 2 86850774 missense unknown
R6158:Olfr1095 UTSW 2 86851515 missense possibly damaging 0.92
R6326:Olfr1095 UTSW 2 86850994 missense probably benign 0.00
R6637:Olfr1095 UTSW 2 86851440 missense probably benign 0.01
Z1176:Olfr1095 UTSW 2 86850940 missense
Predicted Primers PCR Primer
(F):5'- CTACATATCGGTCATAAGCCATTGC -3'
(R):5'- GCTACCATACAGCTATTCTTTCTAGAG -3'

Sequencing Primer
(F):5'- ACATCTGTGTTGCACAACCATG -3'
(R):5'- AGTCTATGTTCATTGATTTACGAGC -3'
Posted On2015-01-23