Incidental Mutation 'R3720:Cstf3'
ID258843
Institutional Source Beutler Lab
Gene Symbol Cstf3
Ensembl Gene ENSMUSG00000027176
Gene Namecleavage stimulation factor, 3' pre-RNA, subunit 3
Synonyms4732468G05Rik
MMRRC Submission 040711-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R3720 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location104590523-104665429 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 104653086 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028599]
PDB Structure Crystal Structure of the HAT-C domain of murine CstF-77 [X-RAY DIFFRACTION]
Crystal structure of HAT domain of murine CstF-77 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028599
SMART Domains Protein: ENSMUSP00000028599
Gene: ENSMUSG00000027176

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
HAT 45 77 4.67e-8 SMART
HAT 79 110 5.04e-4 SMART
HAT 117 152 1.38e-1 SMART
HAT 163 196 4.39e-4 SMART
HAT 229 261 1.19e0 SMART
HAT 271 303 9.12e0 SMART
HAT 319 352 2.73e0 SMART
HAT 354 387 7.31e-1 SMART
HAT 424 456 2.37e0 SMART
HAT 458 494 1.46e0 SMART
low complexity region 597 619 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129571
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of three (including CSTF1 and CSTF2) cleavage stimulation factors that combine to form the cleavage stimulation factor complex (CSTF). This complex is involved in the polyadenylation and 3' end cleavage of pre-mRNAs. The encoded protein functions as a homodimer and interacts directly with both CSTF1 and CSTF2 in the CSTF complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Atp2c1 A T 9: 105,422,976 M708K probably damaging Het
C9 A G 15: 6,483,119 T241A possibly damaging Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cntnap5c T C 17: 58,330,202 S1025P probably benign Het
Col8a1 T C 16: 57,626,916 M744V unknown Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Glt6d1 ACCC ACCCC 2: 25,795,167 probably null Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Hivep1 C T 13: 42,158,601 T1439I probably benign Het
Iqgap2 T C 13: 95,668,528 probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kif1c T C 11: 70,703,771 F86L possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ldb1 C T 19: 46,044,892 probably benign Het
Lrmda T A 14: 22,027,331 probably benign Het
Med23 T C 10: 24,891,120 L369S probably damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myo1b G T 1: 51,776,346 H614N possibly damaging Het
Neurl1b C T 17: 26,414,975 T4M probably damaging Het
Olfr1095 T C 2: 86,851,591 T36A probably benign Het
Olfr129 T C 17: 38,055,368 Y66C probably damaging Het
Polg G A 7: 79,456,791 Q163* probably null Het
Pramef8 A G 4: 143,419,379 T473A probably benign Het
Sdk2 G A 11: 113,800,244 P1835L probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Snx31 T C 15: 36,523,558 probably null Het
Speg A T 1: 75,426,782 H2590L probably damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Swap70 A G 7: 110,270,047 E349G probably damaging Het
Sybu A G 15: 44,672,632 V766A possibly damaging Het
Tns3 G A 11: 8,492,999 R455W probably damaging Het
Tnxb T A 17: 34,712,964 V2157E possibly damaging Het
Trak2 A T 1: 58,946,245 probably null Het
Trav18 C T 14: 53,831,617 R39C possibly damaging Het
Uroc1 G A 6: 90,346,355 V352M probably damaging Het
Zfp106 A C 2: 120,534,599 I442M probably benign Het
Zfp935 G A 13: 62,455,032 Q98* probably null Het
Other mutations in Cstf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01911:Cstf3 APN 2 104646631 missense probably damaging 1.00
IGL02734:Cstf3 APN 2 104609194 splice site probably benign
IGL03025:Cstf3 APN 2 104608931 missense possibly damaging 0.82
Amanita UTSW 2 104590581 start gained probably benign
Ptomaine UTSW 2 104649462 missense probably benign
R0043:Cstf3 UTSW 2 104645085 splice site probably benign
R0189:Cstf3 UTSW 2 104652446 missense probably damaging 1.00
R0332:Cstf3 UTSW 2 104646467 critical splice donor site probably null
R0499:Cstf3 UTSW 2 104649605 missense possibly damaging 0.95
R1476:Cstf3 UTSW 2 104648219 missense possibly damaging 0.82
R1677:Cstf3 UTSW 2 104664278 intron probably benign
R1881:Cstf3 UTSW 2 104654218 missense probably benign
R1916:Cstf3 UTSW 2 104655756 missense possibly damaging 0.90
R3813:Cstf3 UTSW 2 104609121 missense probably damaging 1.00
R5155:Cstf3 UTSW 2 104652485 missense probably benign
R5304:Cstf3 UTSW 2 104663390 nonsense probably null
R5564:Cstf3 UTSW 2 104609002 intron probably benign
R5869:Cstf3 UTSW 2 104659240 splice site probably null
R6172:Cstf3 UTSW 2 104651642 missense probably damaging 1.00
R6747:Cstf3 UTSW 2 104646767 missense probably damaging 1.00
R6841:Cstf3 UTSW 2 104655731 missense probably benign 0.22
R6959:Cstf3 UTSW 2 104649462 missense probably benign
R7139:Cstf3 UTSW 2 104653064 missense possibly damaging 0.87
R7143:Cstf3 UTSW 2 104646616 missense probably benign 0.01
R7350:Cstf3 UTSW 2 104608956 missense probably damaging 1.00
R7794:Cstf3 UTSW 2 104590581 start gained probably benign
R8315:Cstf3 UTSW 2 104590581 start gained probably benign
X0013:Cstf3 UTSW 2 104659277 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TGAGTTCATATACGTTTATGTGCAG -3'
(R):5'- GGGTCCCATGATTTAATAAGACATAAG -3'

Sequencing Primer
(F):5'- CATATACGTTTATGTGCAGTGTAGG -3'
(R):5'- CAGAGGGATTTTTGAGTTCAAGGCC -3'
Posted On2015-01-23