Mutagenetix > Incidental Mutations

Incidental Mutation 'R3720:Zfp106'

258844

Institutional Source

Beutler Lab

Gene Symbol

Zfp106

Ensembl Gene

ENSMUSG00000027288

Gene Name

zinc finger protein 106

Synonyms

Cd-1, H3a, Sh3bp3, sirm

MMRRC Submission

040711-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3720 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

120506820-120563843 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 120534599 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Methionine at position 442 (I442M)

Ref Sequence

ENSEMBL: ENSMUSP00000128995 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055241] [ENSMUST00000135625] [ENSMUST00000171215]

Predicted Effect

probably benign
Transcript: ENSMUST00000055241
AA Change: I465M

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000055602
Gene: ENSMUSG00000027288
AA Change: I465M

Domain	Start	End	E-Value	Type
ZnF_C2H2	5	29	1.51e0	SMART
ZnF_C2H2	43	67	7.18e1	SMART
low complexity region	75	92	N/A	INTRINSIC
low complexity region	141	152	N/A	INTRINSIC
low complexity region	199	212	N/A	INTRINSIC
low complexity region	466	480	N/A	INTRINSIC
coiled coil region	800	823	N/A	INTRINSIC
low complexity region	842	856	N/A	INTRINSIC
low complexity region	1049	1062	N/A	INTRINSIC
low complexity region	1312	1321	N/A	INTRINSIC
low complexity region	1361	1373	N/A	INTRINSIC
low complexity region	1389	1409	N/A	INTRINSIC
WD40	1525	1562	9.24e-4	SMART
WD40	1565	1607	1.83e-7	SMART
PQQ	1587	1618	3.42e2	SMART
WD40	1651	1691	3.45e-1	SMART
PQQ	1671	1702	9.14e1	SMART
WD40	1694	1731	2.12e-3	SMART
PQQ	1711	1742	6.42e0	SMART
WD40	1734	1771	6e-3	SMART
PQQ	1751	1782	5.7e2	SMART
WD40	1774	1811	3.58e-1	SMART
ZnF_C2H2	1818	1843	5.34e-1	SMART
ZnF_C2H2	1851	1879	1.31e2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000135625

SMART Domains

Protein: ENSMUSP00000126939
Gene: ENSMUSG00000027288

Domain	Start	End	E-Value	Type
ZnF_C2H2	5	29	1.51e0	SMART
low complexity region	53	67	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141874

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147353

Predicted Effect

probably benign
Transcript: ENSMUST00000163384

Predicted Effect

probably benign
Transcript: ENSMUST00000167241

SMART Domains

Protein: ENSMUSP00000127803
Gene: ENSMUSG00000027288

Domain	Start	End	E-Value	Type
ZnF_C2H2	4	28	1.51e0	SMART
low complexity region	74	85	N/A	INTRINSIC
low complexity region	132	145	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000171215
AA Change: I442M

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000128995
Gene: ENSMUSG00000027288
AA Change: I442M

Domain	Start	End	E-Value	Type
ZnF_C2H2	20	44	7.18e1	SMART
low complexity region	52	69	N/A	INTRINSIC
low complexity region	118	129	N/A	INTRINSIC
low complexity region	176	189	N/A	INTRINSIC
low complexity region	443	457	N/A	INTRINSIC
coiled coil region	777	800	N/A	INTRINSIC
low complexity region	819	833	N/A	INTRINSIC
low complexity region	1026	1039	N/A	INTRINSIC
low complexity region	1289	1298	N/A	INTRINSIC
low complexity region	1338	1350	N/A	INTRINSIC
low complexity region	1366	1386	N/A	INTRINSIC
WD40	1502	1539	9.24e-4	SMART
WD40	1542	1584	1.83e-7	SMART
PQQ	1564	1595	3.42e2	SMART
WD40	1628	1668	3.45e-1	SMART
PQQ	1648	1679	9.14e1	SMART
WD40	1671	1708	2.12e-3	SMART
PQQ	1688	1719	6.42e0	SMART
WD40	1711	1748	6e-3	SMART
PQQ	1728	1759	5.7e2	SMART
WD40	1751	1788	3.58e-1	SMART
ZnF_C2H2	1795	1820	5.34e-1	SMART
ZnF_C2H2	1828	1856	1.31e2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181963

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 97.0%
20x: 94.0%

Validation Efficiency

93% (40/43)

MGI Phenotype

PHENOTYPE: Mice homozygous for a null allele exhibit an abnormal gait, progressive motor deficits, kyphosis, weight loss, severe adult-onset degenerative sensory-motor axonopathy, mitochondrial dysfunction, and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Appl1	G	A	14: 26,927,844	T575M	probably damaging	Het
Atp2c1	A	T	9: 105,422,976	M708K	probably damaging	Het
C9	A	G	15: 6,483,119	T241A	possibly damaging	Het
Ccrl2	T	C	9: 111,056,364	D22G	probably benign	Het
Cd47	A	G	16: 49,867,842	I42V	probably benign	Het
Cntnap5c	T	C	17: 58,330,202	S1025P	probably benign	Het
Col8a1	T	C	16: 57,626,916	M744V	unknown	Het
Cstf3	A	G	2: 104,653,086		probably benign	Het
Dnah8	G	A	17: 30,854,898	R4514H	probably damaging	Het
Dnaic1	G	A	4: 41,602,615	R113H	probably damaging	Het
Fry	T	C	5: 150,454,572	S410P	probably damaging	Het
Glt6d1	ACCC	ACCCC	2: 25,795,167		probably null	Het
Gm10717	A	G	9: 3,025,532	Y39C	probably benign	Het
Hivep1	C	T	13: 42,158,601	T1439I	probably benign	Het
Iqgap2	T	C	13: 95,668,528		probably null	Het
Kbtbd11	T	A	8: 15,029,118	C572*	probably null	Het
Kif1c	T	C	11: 70,703,771	F86L	possibly damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Ldb1	C	T	19: 46,044,892		probably benign	Het
Lrmda	T	A	14: 22,027,331		probably benign	Het
Med23	T	C	10: 24,891,120	L369S	probably damaging	Het
Mei1	A	G	15: 82,103,204	H399R	possibly damaging	Het
Myo1b	G	T	1: 51,776,346	H614N	possibly damaging	Het
Neurl1b	C	T	17: 26,414,975	T4M	probably damaging	Het
Olfr1095	T	C	2: 86,851,591	T36A	probably benign	Het
Olfr129	T	C	17: 38,055,368	Y66C	probably damaging	Het
Polg	G	A	7: 79,456,791	Q163*	probably null	Het
Pramef8	A	G	4: 143,419,379	T473A	probably benign	Het
Sdk2	G	A	11: 113,800,244	P1835L	probably damaging	Het
Slc35a5	A	T	16: 45,147,322	I138N	probably damaging	Het
Snx31	T	C	15: 36,523,558		probably null	Het
Speg	A	T	1: 75,426,782	H2590L	probably damaging	Het
Spink4	T	A	4: 40,929,136	C54S	probably damaging	Het
Swap70	A	G	7: 110,270,047	E349G	probably damaging	Het
Sybu	A	G	15: 44,672,632	V766A	possibly damaging	Het
Tns3	G	A	11: 8,492,999	R455W	probably damaging	Het
Tnxb	T	A	17: 34,712,964	V2157E	possibly damaging	Het
Trak2	A	T	1: 58,946,245		probably null	Het
Trav18	C	T	14: 53,831,617	R39C	possibly damaging	Het
Uroc1	G	A	6: 90,346,355	V352M	probably damaging	Het
Zfp935	G	A	13: 62,455,032	Q98*	probably null	Het

Other mutations in Zfp106

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Zfp106	APN	2	120539497	missense	probably benign	0.45
IGL00816:Zfp106	APN	2	120526848	missense	probably benign	0.02
IGL00822:Zfp106	APN	2	120514160	missense	probably damaging	1.00
IGL00848:Zfp106	APN	2	120512727	missense	probably damaging	1.00
IGL01293:Zfp106	APN	2	120535035	missense	possibly damaging	0.92
IGL01323:Zfp106	APN	2	120524464	missense	possibly damaging	0.74
IGL01662:Zfp106	APN	2	120523553	missense	probably benign	0.17
IGL01683:Zfp106	APN	2	120524555	missense	probably benign	0.00
IGL01809:Zfp106	APN	2	120533671	missense	probably damaging	1.00
IGL01958:Zfp106	APN	2	120534807	missense	probably benign	0.26
IGL01960:Zfp106	APN	2	120524043	missense	probably damaging	0.99
IGL01960:Zfp106	APN	2	120539322	missense	probably benign	0.08
IGL02168:Zfp106	APN	2	120534231	missense	possibly damaging	0.90
IGL02623:Zfp106	APN	2	120545914	splice site	probably null
IGL02798:Zfp106	APN	2	120510510	missense	probably damaging	1.00
IGL02828:Zfp106	APN	2	120531697	missense	possibly damaging	0.86
IGL03022:Zfp106	APN	2	120528639	splice site	probably benign
IGL03308:Zfp106	APN	2	120524024	missense	probably benign	0.00
IGL03324:Zfp106	APN	2	120535387	missense	probably benign	0.01
lepton	UTSW	2	120532104	missense	probably damaging	0.98
Proton	UTSW	2	120510534	missense	probably damaging	1.00
quark	UTSW	2	120535060	nonsense	probably null
R0040_zfp106_031	UTSW	2	120531613	missense	probably damaging	1.00
string	UTSW	2	120533594	missense	probably damaging	0.96
theory	UTSW	2	120533677	nonsense	probably null
R0040:Zfp106	UTSW	2	120531613	missense	probably damaging	1.00
R0040:Zfp106	UTSW	2	120531613	missense	probably damaging	1.00
R0135:Zfp106	UTSW	2	120520487	missense	probably damaging	0.99
R0180:Zfp106	UTSW	2	120533875	missense	probably damaging	0.96
R0387:Zfp106	UTSW	2	120528472	splice site	probably null
R0558:Zfp106	UTSW	2	120532196	missense	probably damaging	1.00
R0680:Zfp106	UTSW	2	120527016	missense	probably damaging	1.00
R0729:Zfp106	UTSW	2	120555248	missense	probably damaging	0.99
R0828:Zfp106	UTSW	2	120535603	missense	probably benign	0.00
R1124:Zfp106	UTSW	2	120534714	missense	probably benign	0.00
R1147:Zfp106	UTSW	2	120520536	missense	probably damaging	1.00
R1147:Zfp106	UTSW	2	120520536	missense	probably damaging	1.00
R1226:Zfp106	UTSW	2	120524079	missense	probably damaging	1.00
R1239:Zfp106	UTSW	2	120533594	missense	probably damaging	0.96
R1634:Zfp106	UTSW	2	120533677	nonsense	probably null
R1754:Zfp106	UTSW	2	120533763	missense	probably damaging	0.96
R1754:Zfp106	UTSW	2	120533764	missense	probably damaging	0.98
R1755:Zfp106	UTSW	2	120535175	missense	probably damaging	1.00
R1763:Zfp106	UTSW	2	120520428	missense	probably benign	0.03
R1875:Zfp106	UTSW	2	120513615	critical splice donor site	probably null
R1903:Zfp106	UTSW	2	120526848	missense	probably benign	0.02
R1932:Zfp106	UTSW	2	120531681	missense	possibly damaging	0.80
R2070:Zfp106	UTSW	2	120523529	missense	probably benign	0.11
R2301:Zfp106	UTSW	2	120535650	missense	probably benign	0.04
R3429:Zfp106	UTSW	2	120527063	missense	probably benign	0.00
R3875:Zfp106	UTSW	2	120534613	missense	probably benign	0.08
R3881:Zfp106	UTSW	2	120532149	missense	probably benign	0.01
R3921:Zfp106	UTSW	2	120533616	missense	probably damaging	1.00
R3923:Zfp106	UTSW	2	120534856	missense	probably damaging	0.99
R4087:Zfp106	UTSW	2	120526899	splice site	probably null
R4678:Zfp106	UTSW	2	120533740	missense	probably damaging	1.00
R4965:Zfp106	UTSW	2	120533919	missense	probably damaging	0.98
R5011:Zfp106	UTSW	2	120510534	missense	probably damaging	1.00
R5013:Zfp106	UTSW	2	120510534	missense	probably damaging	1.00
R5151:Zfp106	UTSW	2	120534727	missense	probably benign	0.01
R5227:Zfp106	UTSW	2	120523968	missense	probably benign	0.11
R5328:Zfp106	UTSW	2	120520417	missense	possibly damaging	0.73
R5403:Zfp106	UTSW	2	120534781	missense	probably benign	0.02
R5624:Zfp106	UTSW	2	120531957	missense	probably damaging	0.99
R5686:Zfp106	UTSW	2	120533507	splice site	probably null
R5691:Zfp106	UTSW	2	120524471	missense	probably damaging	0.99
R5852:Zfp106	UTSW	2	120516006	missense	probably damaging	1.00
R6032:Zfp106	UTSW	2	120535393	missense	probably benign	0.00
R6032:Zfp106	UTSW	2	120535393	missense	probably benign	0.00
R6298:Zfp106	UTSW	2	120522704	missense	probably damaging	1.00
R6409:Zfp106	UTSW	2	120532104	missense	probably damaging	0.98
R6505:Zfp106	UTSW	2	120534502	missense	probably damaging	0.99
R6598:Zfp106	UTSW	2	120535060	nonsense	probably null
R6765:Zfp106	UTSW	2	120539454	missense	probably damaging	0.96
R7013:Zfp106	UTSW	2	120531632	missense	probably damaging	0.99
R7453:Zfp106	UTSW	2	120510527	missense	probably damaging	1.00
R7453:Zfp106	UTSW	2	120545919	splice site	probably null
R7643:Zfp106	UTSW	2	120512734	missense	probably benign	0.01
R7829:Zfp106	UTSW	2	120524057	missense	possibly damaging	0.94
R7897:Zfp106	UTSW	2	120535615	nonsense	probably null
R7909:Zfp106	UTSW	2	120514219	missense	probably damaging	1.00
R8054:Zfp106	UTSW	2	120524519	missense	possibly damaging	0.93
R8124:Zfp106	UTSW	2	120524331	missense	probably benign	0.44
R8203:Zfp106	UTSW	2	120519078	missense	probably damaging	1.00
R8350:Zfp106	UTSW	2	120535618	missense
R8450:Zfp106	UTSW	2	120535618	missense
R8698:Zfp106	UTSW	2	120524119	critical splice donor site	probably null
RF008:Zfp106	UTSW	2	120524545	small deletion	probably benign
RF025:Zfp106	UTSW	2	120524545	small deletion	probably benign
X0025:Zfp106	UTSW	2	120534816	missense	probably benign
Z1088:Zfp106	UTSW	2	120530490	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTAGGAAGAACCATGGCTACC -3'
(R):5'- GGCAGCAAGTCAGACACACTAG -3'

Sequencing Primer
(F):5'- GAACCATGGCTACCTTCTAAAGTAG -3'
(R):5'- TTTAGCTTAATAACTGCAGGACTG -3'

Posted On

2015-01-23