Incidental Mutation 'R3720:Pramef8'
ID258851
Institutional Source Beutler Lab
Gene Symbol Pramef8
Ensembl Gene ENSMUSG00000046862
Gene NamePRAME family member 8
Synonyms4732496O08Rik
MMRRC Submission 040711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R3720 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location143412426-143421091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143419379 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 473 (T473A)
Ref Sequence ENSEMBL: ENSMUSP00000058676 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037356] [ENSMUST00000059790] [ENSMUST00000132915] [ENSMUST00000155157]
Predicted Effect probably benign
Transcript: ENSMUST00000037356
AA Change: T473A

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041323
Gene: ENSMUSG00000046862
AA Change: T473A

DomainStartEndE-ValueType
SCOP:d1a4ya_ 205 410 3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059790
AA Change: T473A

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000058676
Gene: ENSMUSG00000046862
AA Change: T473A

DomainStartEndE-ValueType
SCOP:d1a4ya_ 205 410 3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132915
Predicted Effect probably benign
Transcript: ENSMUST00000155157
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 93% (40/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Atp2c1 A T 9: 105,422,976 M708K probably damaging Het
C9 A G 15: 6,483,119 T241A possibly damaging Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cntnap5c T C 17: 58,330,202 S1025P probably benign Het
Col8a1 T C 16: 57,626,916 M744V unknown Het
Cstf3 A G 2: 104,653,086 probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Glt6d1 ACCC ACCCC 2: 25,795,167 probably null Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Hivep1 C T 13: 42,158,601 T1439I probably benign Het
Iqgap2 T C 13: 95,668,528 probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kif1c T C 11: 70,703,771 F86L possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ldb1 C T 19: 46,044,892 probably benign Het
Lrmda T A 14: 22,027,331 probably benign Het
Med23 T C 10: 24,891,120 L369S probably damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myo1b G T 1: 51,776,346 H614N possibly damaging Het
Neurl1b C T 17: 26,414,975 T4M probably damaging Het
Olfr1095 T C 2: 86,851,591 T36A probably benign Het
Olfr129 T C 17: 38,055,368 Y66C probably damaging Het
Polg G A 7: 79,456,791 Q163* probably null Het
Sdk2 G A 11: 113,800,244 P1835L probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Snx31 T C 15: 36,523,558 probably null Het
Speg A T 1: 75,426,782 H2590L probably damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Swap70 A G 7: 110,270,047 E349G probably damaging Het
Sybu A G 15: 44,672,632 V766A possibly damaging Het
Tns3 G A 11: 8,492,999 R455W probably damaging Het
Tnxb T A 17: 34,712,964 V2157E possibly damaging Het
Trak2 A T 1: 58,946,245 probably null Het
Trav18 C T 14: 53,831,617 R39C possibly damaging Het
Uroc1 G A 6: 90,346,355 V352M probably damaging Het
Zfp106 A C 2: 120,534,599 I442M probably benign Het
Zfp935 G A 13: 62,455,032 Q98* probably null Het
Other mutations in Pramef8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Pramef8 APN 4 143416667 start codon destroyed probably null 1.00
IGL01483:Pramef8 APN 4 143417477 missense probably damaging 0.99
IGL01800:Pramef8 APN 4 143419080 missense probably damaging 1.00
IGL02063:Pramef8 APN 4 143417851 missense probably benign 0.00
IGL02216:Pramef8 APN 4 143417728 unclassified probably null
IGL02236:Pramef8 APN 4 143416942 missense probably benign 0.07
IGL03013:Pramef8 APN 4 143417467 missense possibly damaging 0.64
R0658:Pramef8 UTSW 4 143417600 missense probably damaging 1.00
R1485:Pramef8 UTSW 4 143417618 missense probably benign 0.01
R2049:Pramef8 UTSW 4 143416871 missense probably damaging 1.00
R2518:Pramef8 UTSW 4 143417903 missense possibly damaging 0.89
R3738:Pramef8 UTSW 4 143416642 utr 5 prime probably benign
R3961:Pramef8 UTSW 4 143419318 missense probably benign 0.00
R4583:Pramef8 UTSW 4 143416754 missense probably damaging 1.00
R5135:Pramef8 UTSW 4 143419009 missense probably benign 0.01
R5348:Pramef8 UTSW 4 143416781 missense probably damaging 1.00
R5473:Pramef8 UTSW 4 143419304 missense probably damaging 1.00
R5977:Pramef8 UTSW 4 143417659 missense probably benign 0.02
R6909:Pramef8 UTSW 4 143417909 missense probably damaging 1.00
R7441:Pramef8 UTSW 4 143418840 missense probably benign 0.00
R7777:Pramef8 UTSW 4 143417761 missense possibly damaging 0.88
R8053:Pramef8 UTSW 4 143417638 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCACACAGCCAGTCTGAGC -3'
(R):5'- CCCATTGTTCTCTAGAAGCTCAGTC -3'

Sequencing Primer
(F):5'- AGCTGACCCAGGAGCTGTATC -3'
(R):5'- AGAAGCTCAGTCTTTGTGGTCTAACC -3'
Posted On2015-01-23