Incidental Mutation 'R3720:Polg'
ID258855
Institutional Source Beutler Lab
Gene Symbol Polg
Ensembl Gene ENSMUSG00000039176
Gene Namepolymerase (DNA directed), gamma
SynonymsPol gamma, Polga, mitochondrial DNA polymerase gamma, mitochondrial DNA polymerase-gamma, polymerase gamma
MMRRC Submission 040711-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3720 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location79446231-79466362 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 79456791 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 163 (Q163*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073889] [ENSMUST00000132048] [ENSMUST00000149444] [ENSMUST00000201907]
Predicted Effect probably null
Transcript: ENSMUST00000073889
AA Change: Q644*
SMART Domains Protein: ENSMUSP00000073551
Gene: ENSMUSG00000039176
AA Change: Q644*

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 131 149 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
POLAc 849 1123 2.23e-107 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127082
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127734
Predicted Effect probably benign
Transcript: ENSMUST00000132048
SMART Domains Protein: ENSMUSP00000143933
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 203 2e-71 PDB
SCOP:d1qm9a1 76 122 3e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139597
Predicted Effect probably null
Transcript: ENSMUST00000139668
AA Change: Q136*
SMART Domains Protein: ENSMUSP00000114414
Gene: ENSMUSG00000039176
AA Change: Q136*

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
PDB:3IKM|D 13 236 1e-125 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142915
Predicted Effect probably null
Transcript: ENSMUST00000143672
AA Change: Q163*
SMART Domains Protein: ENSMUSP00000122286
Gene: ENSMUSG00000039176
AA Change: Q163*

DomainStartEndE-ValueType
PDB:3IKM|D 2 243 1e-117 PDB
SCOP:d1t7pa2 141 243 1e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145154
Predicted Effect probably benign
Transcript: ENSMUST00000149444
SMART Domains Protein: ENSMUSP00000119616
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 490 N/A PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154403
Predicted Effect probably benign
Transcript: ENSMUST00000201030
Predicted Effect probably benign
Transcript: ENSMUST00000201907
SMART Domains Protein: ENSMUSP00000144084
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
Blast:POLAc 1 49 4e-24 BLAST
PDB:3IKM|D 1 50 6e-24 PDB
SCOP:d1t7pa2 21 49 3e-5 SMART
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous proof-reading deficient mutants display reduced life spans and premature aging with weight loss, decreased subcutaneous fat, alopecia, kyphosis, osteoporosis, anemia, reduced fertility, and enlarged hearts. Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Atp2c1 A T 9: 105,422,976 M708K probably damaging Het
C9 A G 15: 6,483,119 T241A possibly damaging Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cntnap5c T C 17: 58,330,202 S1025P probably benign Het
Col8a1 T C 16: 57,626,916 M744V unknown Het
Cstf3 A G 2: 104,653,086 probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Glt6d1 ACCC ACCCC 2: 25,795,167 probably null Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Hivep1 C T 13: 42,158,601 T1439I probably benign Het
Iqgap2 T C 13: 95,668,528 probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kif1c T C 11: 70,703,771 F86L possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ldb1 C T 19: 46,044,892 probably benign Het
Lrmda T A 14: 22,027,331 probably benign Het
Med23 T C 10: 24,891,120 L369S probably damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myo1b G T 1: 51,776,346 H614N possibly damaging Het
Neurl1b C T 17: 26,414,975 T4M probably damaging Het
Olfr1095 T C 2: 86,851,591 T36A probably benign Het
Olfr129 T C 17: 38,055,368 Y66C probably damaging Het
Pramef8 A G 4: 143,419,379 T473A probably benign Het
Sdk2 G A 11: 113,800,244 P1835L probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Snx31 T C 15: 36,523,558 probably null Het
Speg A T 1: 75,426,782 H2590L probably damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Swap70 A G 7: 110,270,047 E349G probably damaging Het
Sybu A G 15: 44,672,632 V766A possibly damaging Het
Tns3 G A 11: 8,492,999 R455W probably damaging Het
Tnxb T A 17: 34,712,964 V2157E possibly damaging Het
Trak2 A T 1: 58,946,245 probably null Het
Trav18 C T 14: 53,831,617 R39C possibly damaging Het
Uroc1 G A 6: 90,346,355 V352M probably damaging Het
Zfp106 A C 2: 120,534,599 I442M probably benign Het
Zfp935 G A 13: 62,455,032 Q98* probably null Het
Other mutations in Polg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Polg APN 7 79451925 missense probably damaging 1.00
IGL00970:Polg APN 7 79451745 missense probably benign 0.01
IGL01883:Polg APN 7 79458318 missense probably damaging 1.00
IGL02124:Polg APN 7 79459737 missense probably damaging 1.00
IGL02127:Polg APN 7 79458167 unclassified probably benign
IGL02820:Polg APN 7 79459771 missense possibly damaging 0.92
IGL03075:Polg APN 7 79451912 missense probably damaging 1.00
IGL03180:Polg APN 7 79451853 splice site probably benign
IGL03198:Polg APN 7 79451722 missense probably damaging 1.00
IGL03222:Polg APN 7 79454656 missense probably damaging 0.98
R0030:Polg UTSW 7 79452128 missense probably damaging 1.00
R0064:Polg UTSW 7 79461884 missense probably damaging 1.00
R0064:Polg UTSW 7 79461884 missense probably damaging 1.00
R0416:Polg UTSW 7 79452240 unclassified probably benign
R0522:Polg UTSW 7 79460151 splice site probably benign
R0638:Polg UTSW 7 79460148 splice site probably benign
R1263:Polg UTSW 7 79459786 missense probably benign
R1831:Polg UTSW 7 79459770 missense probably benign 0.41
R1873:Polg UTSW 7 79456493 missense probably benign 0.04
R1906:Polg UTSW 7 79460322 missense probably damaging 1.00
R1997:Polg UTSW 7 79459231 missense probably damaging 1.00
R2127:Polg UTSW 7 79464928 missense probably damaging 1.00
R2155:Polg UTSW 7 79461720 missense possibly damaging 0.94
R2156:Polg UTSW 7 79461720 missense possibly damaging 0.94
R2173:Polg UTSW 7 79455593 missense probably damaging 0.99
R4082:Polg UTSW 7 79464828 missense probably damaging 1.00
R4127:Polg UTSW 7 79455537 missense probably damaging 1.00
R4510:Polg UTSW 7 79455522 missense probably benign 0.01
R4511:Polg UTSW 7 79455522 missense probably benign 0.01
R4571:Polg UTSW 7 79460379 missense probably damaging 1.00
R4888:Polg UTSW 7 79464605 missense probably damaging 1.00
R5008:Polg UTSW 7 79460074 missense probably damaging 1.00
R5095:Polg UTSW 7 79460300 missense possibly damaging 0.92
R5121:Polg UTSW 7 79464605 missense probably damaging 1.00
R5139:Polg UTSW 7 79450025 missense probably damaging 1.00
R5213:Polg UTSW 7 79454098 missense probably damaging 1.00
R5285:Polg UTSW 7 79465225 utr 5 prime probably benign
R5498:Polg UTSW 7 79454670 missense probably damaging 1.00
R5714:Polg UTSW 7 79451991 missense possibly damaging 0.53
R5940:Polg UTSW 7 79454071 missense possibly damaging 0.95
R6146:Polg UTSW 7 79450512 missense probably benign 0.02
R6754:Polg UTSW 7 79459836 missense probably damaging 1.00
R6791:Polg UTSW 7 79460109 missense probably benign 0.25
R6829:Polg UTSW 7 79460109 missense probably benign 0.25
R6913:Polg UTSW 7 79460657 missense probably damaging 0.97
R7644:Polg UTSW 7 79451668 missense probably damaging 1.00
R7879:Polg UTSW 7 79450644 missense probably benign 0.22
R7962:Polg UTSW 7 79450644 missense probably benign 0.22
Z1176:Polg UTSW 7 79453741 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGCAGCTCTCATACAAAAG -3'
(R):5'- TTGAAACCCAGCCTGTCACC -3'

Sequencing Primer
(F):5'- GGCAGCTCTCATACAAAAGGTGTTC -3'
(R):5'- TCACCAGTGTGCTGAAGTCAG -3'
Posted On2015-01-23