Incidental Mutation 'R3720:Swap70'
ID258856
Institutional Source Beutler Lab
Gene Symbol Swap70
Ensembl Gene ENSMUSG00000031015
Gene NameSWA-70 protein
Synonyms70kDa
MMRRC Submission 040711-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.798) question?
Stock #R3720 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location110221711-110283506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110270047 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 349 (E349G)
Ref Sequence ENSEMBL: ENSMUSP00000033325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033325]
Predicted Effect probably damaging
Transcript: ENSMUST00000033325
AA Change: E349G

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033325
Gene: ENSMUSG00000031015
AA Change: E349G

DomainStartEndE-ValueType
PH 211 308 7.23e-20 SMART
coiled coil region 316 529 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210743
Meta Mutation Damage Score 0.2435 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 93% (40/43)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in increased sensitivity of B lymphocytes to gamma-radiation, increased autoantibody levels, and lower IgE levels, both before and after immunization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Atp2c1 A T 9: 105,422,976 M708K probably damaging Het
C9 A G 15: 6,483,119 T241A possibly damaging Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cntnap5c T C 17: 58,330,202 S1025P probably benign Het
Col8a1 T C 16: 57,626,916 M744V unknown Het
Cstf3 A G 2: 104,653,086 probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Glt6d1 ACCC ACCCC 2: 25,795,167 probably null Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Hivep1 C T 13: 42,158,601 T1439I probably benign Het
Iqgap2 T C 13: 95,668,528 probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kif1c T C 11: 70,703,771 F86L possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ldb1 C T 19: 46,044,892 probably benign Het
Lrmda T A 14: 22,027,331 probably benign Het
Med23 T C 10: 24,891,120 L369S probably damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myo1b G T 1: 51,776,346 H614N possibly damaging Het
Neurl1b C T 17: 26,414,975 T4M probably damaging Het
Olfr1095 T C 2: 86,851,591 T36A probably benign Het
Olfr129 T C 17: 38,055,368 Y66C probably damaging Het
Polg G A 7: 79,456,791 Q163* probably null Het
Pramef8 A G 4: 143,419,379 T473A probably benign Het
Sdk2 G A 11: 113,800,244 P1835L probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Snx31 T C 15: 36,523,558 probably null Het
Speg A T 1: 75,426,782 H2590L probably damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Sybu A G 15: 44,672,632 V766A possibly damaging Het
Tns3 G A 11: 8,492,999 R455W probably damaging Het
Tnxb T A 17: 34,712,964 V2157E possibly damaging Het
Trak2 A T 1: 58,946,245 probably null Het
Trav18 C T 14: 53,831,617 R39C possibly damaging Het
Uroc1 G A 6: 90,346,355 V352M probably damaging Het
Zfp106 A C 2: 120,534,599 I442M probably benign Het
Zfp935 G A 13: 62,455,032 Q98* probably null Het
Other mutations in Swap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01888:Swap70 APN 7 110280634 missense probably damaging 1.00
IGL02307:Swap70 APN 7 110281294 missense probably benign 0.05
IGL02429:Swap70 APN 7 110263972 missense probably benign
IGL02741:Swap70 APN 7 110274649 missense probably benign 0.01
galloping UTSW 7 110269919 missense probably benign
R0037:Swap70 UTSW 7 110264080 missense possibly damaging 0.77
R0041:Swap70 UTSW 7 110279355 missense probably benign 0.04
R0041:Swap70 UTSW 7 110279355 missense probably benign 0.04
R0116:Swap70 UTSW 7 110273282 missense probably benign 0.25
R1615:Swap70 UTSW 7 110273291 missense probably benign 0.01
R1623:Swap70 UTSW 7 110264048 missense probably benign 0.00
R1656:Swap70 UTSW 7 110221827 missense probably benign 0.02
R1932:Swap70 UTSW 7 110279263 missense possibly damaging 0.70
R3753:Swap70 UTSW 7 110267881 missense probably damaging 1.00
R4012:Swap70 UTSW 7 110281305 missense possibly damaging 0.92
R4623:Swap70 UTSW 7 110267872 missense probably benign 0.42
R6158:Swap70 UTSW 7 110270023 missense probably damaging 1.00
R6180:Swap70 UTSW 7 110269981 missense probably damaging 1.00
R6521:Swap70 UTSW 7 110255820 missense probably benign 0.00
R6692:Swap70 UTSW 7 110269919 missense probably benign
R6823:Swap70 UTSW 7 110281303 missense possibly damaging 0.75
R6846:Swap70 UTSW 7 110255749 missense possibly damaging 0.94
R7417:Swap70 UTSW 7 110264109 critical splice donor site probably null
R7466:Swap70 UTSW 7 110274772 missense probably benign 0.19
R7893:Swap70 UTSW 7 110221875 missense probably benign 0.00
R7976:Swap70 UTSW 7 110221875 missense probably benign 0.00
Z1177:Swap70 UTSW 7 110273281 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CGACTGGTGTTACATATTATTCGAG -3'
(R):5'- AAAGCTCCTGAGGCTGTGTG -3'

Sequencing Primer
(F):5'- ATGTTGTAATTCCTGTTCTTTCTCC -3'
(R):5'- CTGTGTGTGGCTTGGGTAC -3'
Posted On2015-01-23