Incidental Mutation 'R3720:C9'
ID258870
Institutional Source Beutler Lab
Gene Symbol C9
Ensembl Gene ENSMUSG00000022149
Gene Namecomplement component 9
Synonyms
MMRRC Submission 040711-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3720 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location6445327-6498751 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6483119 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 241 (T241A)
Ref Sequence ENSEMBL: ENSMUSP00000022749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022749]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022749
AA Change: T241A

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022749
Gene: ENSMUSG00000022149
AA Change: T241A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
TSP1 56 106 1.8e-6 SMART
LDLa 111 147 2.7e-12 SMART
MACPF 304 519 2.9e-52 SMART
Blast:EGF 525 556 4e-11 BLAST
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the final component of the complement system. It participates in the formation of the Membrane Attack Complex (MAC). The MAC assembles on bacterial membranes to form a pore, permitting disruption of bacterial membrane organization. Mutations in this gene cause component C9 deficiency. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Atp2c1 A T 9: 105,422,976 M708K probably damaging Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cntnap5c T C 17: 58,330,202 S1025P probably benign Het
Col8a1 T C 16: 57,626,916 M744V unknown Het
Cstf3 A G 2: 104,653,086 probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Glt6d1 ACCC ACCCC 2: 25,795,167 probably null Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Hivep1 C T 13: 42,158,601 T1439I probably benign Het
Iqgap2 T C 13: 95,668,528 probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kif1c T C 11: 70,703,771 F86L possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ldb1 C T 19: 46,044,892 probably benign Het
Lrmda T A 14: 22,027,331 probably benign Het
Med23 T C 10: 24,891,120 L369S probably damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myo1b G T 1: 51,776,346 H614N possibly damaging Het
Neurl1b C T 17: 26,414,975 T4M probably damaging Het
Olfr1095 T C 2: 86,851,591 T36A probably benign Het
Olfr129 T C 17: 38,055,368 Y66C probably damaging Het
Polg G A 7: 79,456,791 Q163* probably null Het
Pramef8 A G 4: 143,419,379 T473A probably benign Het
Sdk2 G A 11: 113,800,244 P1835L probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Snx31 T C 15: 36,523,558 probably null Het
Speg A T 1: 75,426,782 H2590L probably damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Swap70 A G 7: 110,270,047 E349G probably damaging Het
Sybu A G 15: 44,672,632 V766A possibly damaging Het
Tns3 G A 11: 8,492,999 R455W probably damaging Het
Tnxb T A 17: 34,712,964 V2157E possibly damaging Het
Trak2 A T 1: 58,946,245 probably null Het
Trav18 C T 14: 53,831,617 R39C possibly damaging Het
Uroc1 G A 6: 90,346,355 V352M probably damaging Het
Zfp106 A C 2: 120,534,599 I442M probably benign Het
Zfp935 G A 13: 62,455,032 Q98* probably null Het
Other mutations in C9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:C9 APN 15 6486656 missense probably benign 0.04
IGL00229:C9 APN 15 6483231 missense possibly damaging 0.68
IGL00647:C9 APN 15 6483083 missense probably benign 0.43
IGL01618:C9 APN 15 6459668 missense probably benign 0.38
IGL02530:C9 APN 15 6497132 missense probably benign
R0267:C9 UTSW 15 6467458 missense probably benign 0.00
R0477:C9 UTSW 15 6458183 missense probably benign 0.25
R0552:C9 UTSW 15 6445437 missense probably damaging 0.98
R0701:C9 UTSW 15 6467421 missense probably damaging 1.00
R0792:C9 UTSW 15 6486762 missense probably damaging 1.00
R0881:C9 UTSW 15 6458868 splice site probably benign
R1281:C9 UTSW 15 6489840 missense possibly damaging 0.80
R1384:C9 UTSW 15 6458934 missense probably benign 0.08
R1522:C9 UTSW 15 6486762 missense probably damaging 1.00
R1988:C9 UTSW 15 6483138 frame shift probably null
R2229:C9 UTSW 15 6445420 missense possibly damaging 0.95
R2406:C9 UTSW 15 6483299 missense possibly damaging 0.76
R3723:C9 UTSW 15 6483080 missense possibly damaging 0.77
R3929:C9 UTSW 15 6467458 missense probably benign 0.00
R4371:C9 UTSW 15 6491484 missense probably damaging 1.00
R4615:C9 UTSW 15 6491463 missense probably damaging 0.99
R4616:C9 UTSW 15 6491463 missense probably damaging 0.99
R4618:C9 UTSW 15 6491463 missense probably damaging 0.99
R4749:C9 UTSW 15 6489830 missense probably benign 0.19
R4764:C9 UTSW 15 6459643 missense probably damaging 1.00
R5544:C9 UTSW 15 6497027 missense probably damaging 0.99
R5723:C9 UTSW 15 6486816 missense probably damaging 1.00
R5813:C9 UTSW 15 6497126 missense probably benign 0.05
R6735:C9 UTSW 15 6489906 missense probably benign 0.06
R6754:C9 UTSW 15 6489943 nonsense probably null
R6956:C9 UTSW 15 6445464 missense probably benign
R7706:C9 UTSW 15 6458921 missense probably benign 0.08
R7791:C9 UTSW 15 6489878 missense possibly damaging 0.82
R7893:C9 UTSW 15 6483245 missense possibly damaging 0.94
R7976:C9 UTSW 15 6483245 missense possibly damaging 0.94
R8185:C9 UTSW 15 6491397 missense probably damaging 1.00
Z1177:C9 UTSW 15 6491519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTCTGTACTTGAACCACAG -3'
(R):5'- TCCAGTTCTTACCGACTGCG -3'

Sequencing Primer
(F):5'- TCTGTACTTGAACCACAGAAACCTG -3'
(R):5'- GTTCTTACCGACTGCGAAAAATAAG -3'
Posted On2015-01-23