Incidental Mutation 'R3720:Mei1'
ID258873
Institutional Source Beutler Lab
Gene Symbol Mei1
Ensembl Gene ENSMUSG00000068117
Gene Namemeiotic double-stranded break formation protein 1
Synonymsmei1
MMRRC Submission 040711-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R3720 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location82069996-82126814 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82103204 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 399 (H399R)
Ref Sequence ENSEMBL: ENSMUSP00000140479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089178] [ENSMUST00000186125] [ENSMUST00000188048] [ENSMUST00000189540] [ENSMUST00000229119]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089178
AA Change: H773R

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000086582
Gene: ENSMUSG00000068117
AA Change: H773R

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
SCOP:d1gw5a_ 123 498 1e-3 SMART
low complexity region 956 966 N/A INTRINSIC
low complexity region 1025 1045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186125
Predicted Effect possibly damaging
Transcript: ENSMUST00000188048
AA Change: H399R

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139689
Gene: ENSMUSG00000068117
AA Change: H399R

DomainStartEndE-ValueType
low complexity region 523 536 N/A INTRINSIC
low complexity region 595 615 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189540
AA Change: H399R

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140479
Gene: ENSMUSG00000068117
AA Change: H399R

DomainStartEndE-ValueType
low complexity region 523 536 N/A INTRINSIC
low complexity region 595 615 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000229119
AA Change: H823R

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.6918 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 93% (40/43)
MGI Phenotype PHENOTYPE: Homozygous mutant mice of both sexes exhibit meiotic defects and are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Atp2c1 A T 9: 105,422,976 M708K probably damaging Het
C9 A G 15: 6,483,119 T241A possibly damaging Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cntnap5c T C 17: 58,330,202 S1025P probably benign Het
Col8a1 T C 16: 57,626,916 M744V unknown Het
Cstf3 A G 2: 104,653,086 probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Glt6d1 ACCC ACCCC 2: 25,795,167 probably null Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Hivep1 C T 13: 42,158,601 T1439I probably benign Het
Iqgap2 T C 13: 95,668,528 probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kif1c T C 11: 70,703,771 F86L possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ldb1 C T 19: 46,044,892 probably benign Het
Lrmda T A 14: 22,027,331 probably benign Het
Med23 T C 10: 24,891,120 L369S probably damaging Het
Myo1b G T 1: 51,776,346 H614N possibly damaging Het
Neurl1b C T 17: 26,414,975 T4M probably damaging Het
Olfr1095 T C 2: 86,851,591 T36A probably benign Het
Olfr129 T C 17: 38,055,368 Y66C probably damaging Het
Polg G A 7: 79,456,791 Q163* probably null Het
Pramef8 A G 4: 143,419,379 T473A probably benign Het
Sdk2 G A 11: 113,800,244 P1835L probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Snx31 T C 15: 36,523,558 probably null Het
Speg A T 1: 75,426,782 H2590L probably damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Swap70 A G 7: 110,270,047 E349G probably damaging Het
Sybu A G 15: 44,672,632 V766A possibly damaging Het
Tns3 G A 11: 8,492,999 R455W probably damaging Het
Tnxb T A 17: 34,712,964 V2157E possibly damaging Het
Trak2 A T 1: 58,946,245 probably null Het
Trav18 C T 14: 53,831,617 R39C possibly damaging Het
Uroc1 G A 6: 90,346,355 V352M probably damaging Het
Zfp106 A C 2: 120,534,599 I442M probably benign Het
Zfp935 G A 13: 62,455,032 Q98* probably null Het
Other mutations in Mei1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01612:Mei1 APN 15 82089552 missense probably damaging 0.99
IGL01776:Mei1 APN 15 82095932 critical splice donor site probably null
IGL01864:Mei1 APN 15 82113017 splice site probably benign
IGL02030:Mei1 APN 15 82115743 missense probably benign
IGL02148:Mei1 APN 15 82092711 nonsense probably null
R0135:Mei1 UTSW 15 82071969 nonsense probably null
R0212:Mei1 UTSW 15 82095931 critical splice donor site probably null
R0537:Mei1 UTSW 15 82091361 missense possibly damaging 0.93
R0605:Mei1 UTSW 15 82070150 missense probably benign
R0727:Mei1 UTSW 15 82070149 missense probably benign 0.01
R1118:Mei1 UTSW 15 82115867 splice site probably benign
R1226:Mei1 UTSW 15 82080084 missense possibly damaging 0.92
R1339:Mei1 UTSW 15 82081995 missense possibly damaging 0.66
R1558:Mei1 UTSW 15 82107133 missense probably damaging 1.00
R1769:Mei1 UTSW 15 82112570 splice site probably null
R1868:Mei1 UTSW 15 82124953 missense probably damaging 1.00
R1980:Mei1 UTSW 15 82103312 missense probably benign 0.00
R1981:Mei1 UTSW 15 82103312 missense probably benign 0.00
R1982:Mei1 UTSW 15 82103312 missense probably benign 0.00
R2103:Mei1 UTSW 15 82103204 missense possibly damaging 0.91
R2103:Mei1 UTSW 15 82107036 missense probably damaging 0.99
R2207:Mei1 UTSW 15 82103249 missense probably benign 0.08
R2444:Mei1 UTSW 15 82112941 missense probably damaging 1.00
R3009:Mei1 UTSW 15 82112525 missense probably damaging 0.97
R3114:Mei1 UTSW 15 82124959 missense probably benign 0.31
R3546:Mei1 UTSW 15 82098042 missense probably damaging 0.97
R3721:Mei1 UTSW 15 82103204 missense possibly damaging 0.91
R3722:Mei1 UTSW 15 82103204 missense possibly damaging 0.91
R3752:Mei1 UTSW 15 82086182 missense probably damaging 0.97
R3778:Mei1 UTSW 15 82082008 missense probably damaging 1.00
R3848:Mei1 UTSW 15 82113017 splice site probably benign
R3933:Mei1 UTSW 15 82083152 missense possibly damaging 0.75
R4274:Mei1 UTSW 15 82124863 missense possibly damaging 0.66
R4765:Mei1 UTSW 15 82112485 missense possibly damaging 0.96
R5070:Mei1 UTSW 15 82077603 missense possibly damaging 0.66
R5394:Mei1 UTSW 15 82092756 missense possibly damaging 0.83
R6108:Mei1 UTSW 15 82075188 missense possibly damaging 0.66
R6302:Mei1 UTSW 15 82103238 nonsense probably null
R6849:Mei1 UTSW 15 82079945 missense possibly damaging 0.92
R6913:Mei1 UTSW 15 82089609 missense probably benign 0.06
R6919:Mei1 UTSW 15 82081930 missense probably damaging 0.98
R6959:Mei1 UTSW 15 82124875 missense probably benign 0.01
R7007:Mei1 UTSW 15 82093999 missense probably damaging 0.99
R7202:Mei1 UTSW 15 82092642 missense
R7374:Mei1 UTSW 15 82095908 missense
R7438:Mei1 UTSW 15 82115481 missense
R7757:Mei1 UTSW 15 82082623 intron probably benign
R7857:Mei1 UTSW 15 82092717 missense not run
R8265:Mei1 UTSW 15 82103307 nonsense probably null
R8728:Mei1 UTSW 15 82081981 missense
RF051:Mei1 UTSW 15 82070010 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCATTCTGATGAGCAGCGTG -3'
(R):5'- CTACCAGCAAAATGAGTAGGATGC -3'

Sequencing Primer
(F):5'- CAGCGTGCTGTTCTGGGATG -3'
(R):5'- CTCTGGAGCACACGGAACAG -3'
Posted On2015-01-23