Incidental Mutation 'R3720:Cd47'
ID258875
Institutional Source Beutler Lab
Gene Symbol Cd47
Ensembl Gene ENSMUSG00000055447
Gene NameCD47 antigen (Rh-related antigen, integrin-associated signal transducer)
SynonymsB430305P08Rik, 9130415E20Rik, integrin-associated protein, Itgp, IAP
MMRRC Submission 040711-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3720 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location49800533-49915010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49867842 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 42 (I42V)
Ref Sequence ENSEMBL: ENSMUSP00000155178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084838] [ENSMUST00000114496] [ENSMUST00000229101] [ENSMUST00000229104] [ENSMUST00000229206] [ENSMUST00000229640] [ENSMUST00000230281] [ENSMUST00000230641] [ENSMUST00000230836]
Predicted Effect probably benign
Transcript: ENSMUST00000084838
AA Change: I42V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099853
Gene: ENSMUSG00000055447
AA Change: I42V

DomainStartEndE-ValueType
Pfam:V-set_CD47 8 137 2.2e-46 PFAM
Pfam:CD47 163 317 4.7e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114496
SMART Domains Protein: ENSMUSP00000110140
Gene: ENSMUSG00000055447

DomainStartEndE-ValueType
Pfam:V-set_CD47 1 41 1.8e-15 PFAM
Pfam:CD47 42 199 6.8e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229101
Predicted Effect probably benign
Transcript: ENSMUST00000229104
Predicted Effect probably benign
Transcript: ENSMUST00000229206
AA Change: I42V

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000229640
Predicted Effect probably benign
Transcript: ENSMUST00000230281
Predicted Effect probably benign
Transcript: ENSMUST00000230641
AA Change: I42V

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000230836
AA Change: I42V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231187
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which is involved in the increase in intracellular calcium concentration that occurs upon cell adhesion to extracellular matrix. The encoded protein is also a receptor for the C-terminal cell binding domain of thrombospondin, and it may play a role in membrane transport and signal transduction. This gene has broad tissue distribution, and is reduced in expression on Rh erythrocytes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous mutation of this gene results in a reduced CD3+ fraction of peripheral lymphocytes and inability to clear infection by E.coli. Mutant animals are otherwise normal in appearance, survival, and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Atp2c1 A T 9: 105,422,976 M708K probably damaging Het
C9 A G 15: 6,483,119 T241A possibly damaging Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cntnap5c T C 17: 58,330,202 S1025P probably benign Het
Col8a1 T C 16: 57,626,916 M744V unknown Het
Cstf3 A G 2: 104,653,086 probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Glt6d1 ACCC ACCCC 2: 25,795,167 probably null Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Hivep1 C T 13: 42,158,601 T1439I probably benign Het
Iqgap2 T C 13: 95,668,528 probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kif1c T C 11: 70,703,771 F86L possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ldb1 C T 19: 46,044,892 probably benign Het
Lrmda T A 14: 22,027,331 probably benign Het
Med23 T C 10: 24,891,120 L369S probably damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myo1b G T 1: 51,776,346 H614N possibly damaging Het
Neurl1b C T 17: 26,414,975 T4M probably damaging Het
Olfr1095 T C 2: 86,851,591 T36A probably benign Het
Olfr129 T C 17: 38,055,368 Y66C probably damaging Het
Polg G A 7: 79,456,791 Q163* probably null Het
Pramef8 A G 4: 143,419,379 T473A probably benign Het
Sdk2 G A 11: 113,800,244 P1835L probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Snx31 T C 15: 36,523,558 probably null Het
Speg A T 1: 75,426,782 H2590L probably damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Swap70 A G 7: 110,270,047 E349G probably damaging Het
Sybu A G 15: 44,672,632 V766A possibly damaging Het
Tns3 G A 11: 8,492,999 R455W probably damaging Het
Tnxb T A 17: 34,712,964 V2157E possibly damaging Het
Trak2 A T 1: 58,946,245 probably null Het
Trav18 C T 14: 53,831,617 R39C possibly damaging Het
Uroc1 G A 6: 90,346,355 V352M probably damaging Het
Zfp106 A C 2: 120,534,599 I442M probably benign Het
Zfp935 G A 13: 62,455,032 Q98* probably null Het
Other mutations in Cd47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03253:Cd47 APN 16 49894198 missense probably benign 0.11
R0675:Cd47 UTSW 16 49906799 missense possibly damaging 0.61
R1374:Cd47 UTSW 16 49894180 missense probably damaging 1.00
R1651:Cd47 UTSW 16 49894228 missense possibly damaging 0.93
R1712:Cd47 UTSW 16 49894180 missense probably damaging 1.00
R1803:Cd47 UTSW 16 49867806 missense possibly damaging 0.87
R3722:Cd47 UTSW 16 49867842 missense probably benign 0.09
R4525:Cd47 UTSW 16 49867792 missense probably benign 0.15
R5366:Cd47 UTSW 16 49896373 missense probably damaging 1.00
R6878:Cd47 UTSW 16 49910869 missense possibly damaging 0.82
R7219:Cd47 UTSW 16 49908077 missense possibly damaging 0.50
R7470:Cd47 UTSW 16 49884222 missense
R8068:Cd47 UTSW 16 49895416 missense
Predicted Primers PCR Primer
(F):5'- ACCTTGTTCCTGTACTACAAGC -3'
(R):5'- GTAGTTTCCCACCATGGCATCG -3'

Sequencing Primer
(F):5'- CTACAAGCATAAATGAACAGTTGCAG -3'
(R):5'- CGCGCTTATCCATTTTCAAAGAGG -3'
Posted On2015-01-23