Incidental Mutation 'R3720:Col8a1'
ID258876
Institutional Source Beutler Lab
Gene Symbol Col8a1
Ensembl Gene ENSMUSG00000068196
Gene Namecollagen, type VIII, alpha 1
SynonymsCol8a-1
MMRRC Submission 040711-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3720 (G1)
Quality Score204
Status Validated
Chromosome16
Chromosomal Location57624258-57754737 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57626916 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 744 (M744V)
Ref Sequence ENSEMBL: ENSMUSP00000086745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089332]
PDB Structure
Crystal Structure of a Collagen VIII NC1 Domain Trimer [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000089332
AA Change: M744V
SMART Domains Protein: ENSMUSP00000086745
Gene: ENSMUSG00000068196
AA Change: M744V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 31 57 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
low complexity region 122 145 N/A INTRINSIC
Pfam:Collagen 158 212 5.4e-9 PFAM
low complexity region 376 436 N/A INTRINSIC
Pfam:Collagen 469 534 2.6e-10 PFAM
Pfam:Collagen 517 586 4.9e-8 PFAM
C1Q 609 744 1.14e-78 SMART
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency 93% (40/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the two alpha chains of type VIII collagen. The gene product is a short chain collagen and a major component of the basement membrane of the corneal endothelium. The type VIII collagen fibril can be either a homo- or a heterotrimer. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mutation of this gene causes cornea abnormalities that include increased depth of the anterior chamber and a thinner corneal stroma and Descemet's membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Atp2c1 A T 9: 105,422,976 M708K probably damaging Het
C9 A G 15: 6,483,119 T241A possibly damaging Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cntnap5c T C 17: 58,330,202 S1025P probably benign Het
Cstf3 A G 2: 104,653,086 probably benign Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Fry T C 5: 150,454,572 S410P probably damaging Het
Glt6d1 ACCC ACCCC 2: 25,795,167 probably null Het
Gm10717 A G 9: 3,025,532 Y39C probably benign Het
Hivep1 C T 13: 42,158,601 T1439I probably benign Het
Iqgap2 T C 13: 95,668,528 probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kif1c T C 11: 70,703,771 F86L possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Ldb1 C T 19: 46,044,892 probably benign Het
Lrmda T A 14: 22,027,331 probably benign Het
Med23 T C 10: 24,891,120 L369S probably damaging Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myo1b G T 1: 51,776,346 H614N possibly damaging Het
Neurl1b C T 17: 26,414,975 T4M probably damaging Het
Olfr1095 T C 2: 86,851,591 T36A probably benign Het
Olfr129 T C 17: 38,055,368 Y66C probably damaging Het
Polg G A 7: 79,456,791 Q163* probably null Het
Pramef8 A G 4: 143,419,379 T473A probably benign Het
Sdk2 G A 11: 113,800,244 P1835L probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Snx31 T C 15: 36,523,558 probably null Het
Speg A T 1: 75,426,782 H2590L probably damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Swap70 A G 7: 110,270,047 E349G probably damaging Het
Sybu A G 15: 44,672,632 V766A possibly damaging Het
Tns3 G A 11: 8,492,999 R455W probably damaging Het
Tnxb T A 17: 34,712,964 V2157E possibly damaging Het
Trak2 A T 1: 58,946,245 probably null Het
Trav18 C T 14: 53,831,617 R39C possibly damaging Het
Uroc1 G A 6: 90,346,355 V352M probably damaging Het
Zfp106 A C 2: 120,534,599 I442M probably benign Het
Zfp935 G A 13: 62,455,032 Q98* probably null Het
Other mutations in Col8a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Col8a1 APN 16 57627734 missense unknown
IGL01779:Col8a1 APN 16 57628363 missense unknown
IGL03024:Col8a1 APN 16 57628364 missense unknown
R0383:Col8a1 UTSW 16 57632442 missense probably damaging 1.00
R0931:Col8a1 UTSW 16 57628568 missense unknown
R1912:Col8a1 UTSW 16 57627924 missense unknown
R6252:Col8a1 UTSW 16 57627005 missense unknown
R7569:Col8a1 UTSW 16 57627192 missense unknown
Z1177:Col8a1 UTSW 16 57628238 missense unknown
Z1177:Col8a1 UTSW 16 57632450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGTGCACAGGACTAAAC -3'
(R):5'- CAACGTATGGGTTGCTCTCTTC -3'

Sequencing Primer
(F):5'- GCACAGGACTAAACATGCGTTTTAG -3'
(R):5'- ATGGGTTGCTCTCTTCAAGAAC -3'
Posted On2015-01-23