Incidental Mutation 'R3721:Pkhd1'
ID 258881
Institutional Source Beutler Lab
Gene Symbol Pkhd1
Ensembl Gene ENSMUSG00000043760
Gene Name polycystic kidney and hepatic disease 1
Synonyms FPC, tigmin
MMRRC Submission 040712-MU
Accession Numbers

Genbank: NM_153179; MGI: 2155808

Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R3721 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 20057779-20618064 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 20585655 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 218 (D218G)
Ref Sequence ENSEMBL: ENSMUSP00000085794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088448]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000088448
AA Change: D218G

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760
AA Change: D218G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:IPT 134 254 1e-45 BLAST
IPT 256 353 1.13e-3 SMART
low complexity region 722 743 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Pfam:TIG 936 1005 9.1e-8 PFAM
IPT 1016 1101 1.18e-6 SMART
IPT 1105 1190 1.27e0 SMART
IPT 1193 1290 7.05e-5 SMART
IPT 1384 1467 1.36e1 SMART
IPT 1568 1655 2.4e0 SMART
low complexity region 1881 1892 N/A INTRINSIC
G8 1928 2049 1.15e-48 SMART
low complexity region 2079 2094 N/A INTRINSIC
PbH1 2244 2266 7.82e3 SMART
PbH1 2287 2321 2.23e3 SMART
PbH1 2404 2426 7.19e2 SMART
PbH1 2459 2481 2.64e2 SMART
low complexity region 2713 2728 N/A INTRINSIC
G8 2734 2867 1.73e-43 SMART
Blast:G8 2876 2923 2e-17 BLAST
PbH1 3004 3026 3.98e3 SMART
PbH1 3027 3049 1.27e0 SMART
PbH1 3080 3102 5.92e2 SMART
low complexity region 3178 3187 N/A INTRINSIC
PbH1 3188 3212 8.08e3 SMART
transmembrane domain 3852 3874 N/A INTRINSIC
Meta Mutation Damage Score 0.2171 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a T C 2: 48,892,138 (GRCm38) S228P probably damaging Het
Adamts2 C T 11: 50,773,211 (GRCm38) probably benign Het
Arhgap9 A G 10: 127,328,971 (GRCm38) E588G possibly damaging Het
Ash2l C G 8: 25,818,625 (GRCm38) G453A probably damaging Het
Catsperg2 A G 7: 29,705,102 (GRCm38) V638A probably benign Het
Ccrl2 T C 9: 111,056,364 (GRCm38) D22G probably benign Het
Cdc73 T C 1: 143,695,453 (GRCm38) I83V possibly damaging Het
Clec2e C A 6: 129,094,410 (GRCm38) E155* probably null Het
Cyp3a59 T A 5: 146,096,597 (GRCm38) M181K probably damaging Het
Dars2 A T 1: 161,063,308 (GRCm38) V111E probably benign Het
Diras2 T A 13: 52,508,023 (GRCm38) I83F probably damaging Het
Dlg2 T A 7: 91,711,800 (GRCm38) probably null Het
Dnaic1 G A 4: 41,602,615 (GRCm38) R113H probably damaging Het
Emilin2 T C 17: 71,273,454 (GRCm38) N759S probably benign Het
F11 A G 8: 45,248,638 (GRCm38) S353P probably damaging Het
Fam102b C T 3: 108,979,767 (GRCm38) R305Q probably damaging Het
Ggnbp1 T C 17: 27,029,613 (GRCm38) V52A probably benign Het
Gm5155 A G 7: 17,902,738 (GRCm38) T247A probably benign Het
Gpr171 A G 3: 59,097,670 (GRCm38) V228A possibly damaging Het
Gsta3 T C 1: 21,260,089 (GRCm38) M55T probably benign Het
Hectd3 T A 4: 116,999,745 (GRCm38) N496K probably benign Het
Hp1bp3 T G 4: 138,239,608 (GRCm38) F367V probably damaging Het
Il18rap T A 1: 40,537,088 (GRCm38) L253Q probably damaging Het
Irs1 C T 1: 82,290,085 (GRCm38) G137S probably benign Het
Kirrel C T 3: 87,089,151 (GRCm38) M380I probably null Het
Lair1 A C 7: 4,010,783 (GRCm38) L155R probably damaging Het
Larp7 A G 3: 127,546,811 (GRCm38) L126P probably damaging Het
Lhx1 G A 11: 84,521,828 (GRCm38) R89C probably damaging Het
Lypd4 C A 7: 24,865,459 (GRCm38) A85S probably benign Het
Mei1 A G 15: 82,103,204 (GRCm38) H399R possibly damaging Het
Myh10 G T 11: 68,813,052 (GRCm38) R1863L probably damaging Het
Myo9a G A 9: 59,868,180 (GRCm38) V1025I probably benign Het
Naa25 T A 5: 121,431,556 (GRCm38) D659E probably benign Het
Nol9 A G 4: 152,039,706 (GRCm38) S118G probably benign Het
Olfr497 G T 7: 108,423,119 (GRCm38) D183Y probably damaging Het
Olfr730 C T 14: 50,186,680 (GRCm38) C179Y probably damaging Het
Pde10a T A 17: 8,969,589 (GRCm38) I907N probably damaging Het
Poll A G 19: 45,553,577 (GRCm38) I430T probably damaging Het
Pomgnt1 T G 4: 116,153,543 (GRCm38) probably benign Het
Rab6b T C 9: 103,167,174 (GRCm38) probably null Het
Rad1 T C 15: 10,488,026 (GRCm38) S79P probably benign Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 (GRCm38) probably benign Het
Rcc1 T C 4: 132,337,814 (GRCm38) K133E possibly damaging Het
Ric8a T C 7: 140,861,961 (GRCm38) probably null Het
Rnf135 G T 11: 80,196,917 (GRCm38) A231S probably benign Het
Rps6ka4 A G 19: 6,839,277 (GRCm38) V146A possibly damaging Het
Sh3bp4 A G 1: 89,145,328 (GRCm38) I633V possibly damaging Het
Slc2a2 T A 3: 28,727,152 (GRCm38) N446K probably damaging Het
Slc44a1 T C 4: 53,491,445 (GRCm38) Y61H probably damaging Het
Slc7a1 G A 5: 148,335,533 (GRCm38) R445* probably null Het
Smc5 T C 19: 23,210,492 (GRCm38) M911V probably benign Het
Sntb1 C A 15: 55,642,818 (GRCm38) R453L probably benign Het
Spink4 T A 4: 40,929,136 (GRCm38) C54S probably damaging Het
Srrm2 CTCCTCTTCTTCCTCTTCTTCCTC CTCCTCTTCTTCCTC 17: 23,822,575 (GRCm38) probably benign Het
Trpm1 T G 7: 64,217,727 (GRCm38) probably benign Het
Tufm T C 7: 126,490,460 (GRCm38) M442T probably benign Het
Ubn1 A G 16: 5,073,378 (GRCm38) N539S possibly damaging Het
Other mutations in Pkhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Pkhd1 APN 1 20,566,874 (GRCm38) critical splice acceptor site probably null
IGL00687:Pkhd1 APN 1 20,524,070 (GRCm38) missense probably benign 0.19
IGL00824:Pkhd1 APN 1 20,081,184 (GRCm38) critical splice donor site probably null
IGL00870:Pkhd1 APN 1 20,571,390 (GRCm38) missense probably damaging 1.00
IGL00911:Pkhd1 APN 1 20,117,747 (GRCm38) missense probably benign 0.00
IGL01015:Pkhd1 APN 1 20,523,258 (GRCm38) missense possibly damaging 0.95
IGL01025:Pkhd1 APN 1 20,209,176 (GRCm38) missense probably benign 0.04
IGL01064:Pkhd1 APN 1 20,534,530 (GRCm38) splice site probably benign
IGL01313:Pkhd1 APN 1 20,201,024 (GRCm38) missense probably damaging 1.00
IGL01340:Pkhd1 APN 1 20,522,977 (GRCm38) missense probably benign 0.01
IGL01352:Pkhd1 APN 1 20,549,715 (GRCm38) missense probably benign 0.34
IGL01456:Pkhd1 APN 1 20,199,459 (GRCm38) missense probably damaging 1.00
IGL01530:Pkhd1 APN 1 20,559,419 (GRCm38) critical splice donor site probably null
IGL01557:Pkhd1 APN 1 20,116,979 (GRCm38) missense possibly damaging 0.59
IGL01655:Pkhd1 APN 1 20,534,633 (GRCm38) nonsense probably null
IGL01790:Pkhd1 APN 1 20,558,671 (GRCm38) missense probably damaging 0.96
IGL01862:Pkhd1 APN 1 20,358,910 (GRCm38) missense probably damaging 1.00
IGL01874:Pkhd1 APN 1 20,103,235 (GRCm38) missense probably benign 0.32
IGL01901:Pkhd1 APN 1 20,220,083 (GRCm38) missense probably benign 0.11
IGL01903:Pkhd1 APN 1 20,198,137 (GRCm38) missense probably damaging 1.00
IGL01981:Pkhd1 APN 1 20,523,567 (GRCm38) missense possibly damaging 0.64
IGL02068:Pkhd1 APN 1 20,522,747 (GRCm38) missense probably damaging 1.00
IGL02083:Pkhd1 APN 1 20,201,227 (GRCm38) missense probably damaging 1.00
IGL02084:Pkhd1 APN 1 20,377,399 (GRCm38) missense probably damaging 1.00
IGL02126:Pkhd1 APN 1 20,117,195 (GRCm38) missense probably damaging 1.00
IGL02136:Pkhd1 APN 1 20,275,615 (GRCm38) missense probably damaging 1.00
IGL02255:Pkhd1 APN 1 20,584,101 (GRCm38) missense probably damaging 1.00
IGL02272:Pkhd1 APN 1 20,209,260 (GRCm38) missense probably damaging 1.00
IGL02308:Pkhd1 APN 1 20,070,376 (GRCm38) critical splice donor site probably null
IGL02364:Pkhd1 APN 1 20,200,783 (GRCm38) missense probably benign
IGL02389:Pkhd1 APN 1 20,117,720 (GRCm38) missense probably damaging 0.99
IGL02394:Pkhd1 APN 1 20,199,486 (GRCm38) missense possibly damaging 0.57
IGL02403:Pkhd1 APN 1 20,562,418 (GRCm38) missense probably benign 0.01
IGL02415:Pkhd1 APN 1 20,414,421 (GRCm38) missense probably damaging 1.00
IGL02415:Pkhd1 APN 1 20,522,759 (GRCm38) missense probably damaging 1.00
IGL02455:Pkhd1 APN 1 20,364,201 (GRCm38) missense probably damaging 1.00
IGL02502:Pkhd1 APN 1 20,392,165 (GRCm38) missense probably damaging 1.00
IGL02511:Pkhd1 APN 1 20,073,507 (GRCm38) missense possibly damaging 0.90
IGL02530:Pkhd1 APN 1 20,117,720 (GRCm38) missense probably damaging 0.99
IGL02532:Pkhd1 APN 1 20,117,720 (GRCm38) missense probably damaging 0.99
IGL02534:Pkhd1 APN 1 20,117,720 (GRCm38) missense probably damaging 0.99
IGL02556:Pkhd1 APN 1 20,310,710 (GRCm38) missense probably damaging 1.00
IGL02570:Pkhd1 APN 1 20,520,256 (GRCm38) missense probably damaging 0.99
IGL02605:Pkhd1 APN 1 20,550,902 (GRCm38) missense possibly damaging 0.66
IGL02641:Pkhd1 APN 1 20,558,752 (GRCm38) missense possibly damaging 0.61
IGL02741:Pkhd1 APN 1 20,220,029 (GRCm38) splice site probably benign
IGL02752:Pkhd1 APN 1 20,553,591 (GRCm38) missense possibly damaging 0.57
IGL02890:Pkhd1 APN 1 20,361,011 (GRCm38) missense probably damaging 1.00
IGL02959:Pkhd1 APN 1 20,608,416 (GRCm38) nonsense probably null
IGL02960:Pkhd1 APN 1 20,377,446 (GRCm38) missense possibly damaging 0.69
IGL02990:Pkhd1 APN 1 20,522,963 (GRCm38) missense possibly damaging 0.52
IGL03037:Pkhd1 APN 1 20,522,699 (GRCm38) missense probably benign 0.06
IGL03082:Pkhd1 APN 1 20,565,633 (GRCm38) missense probably damaging 1.00
IGL03114:Pkhd1 APN 1 20,198,171 (GRCm38) missense probably damaging 0.99
IGL03288:Pkhd1 APN 1 20,201,019 (GRCm38) missense probably benign 0.01
IGL03328:Pkhd1 APN 1 20,081,300 (GRCm38) splice site probably benign
IGL03375:Pkhd1 APN 1 20,117,023 (GRCm38) missense probably damaging 1.00
IGL03380:Pkhd1 APN 1 20,200,670 (GRCm38) missense probably damaging 1.00
0152:Pkhd1 UTSW 1 20,522,894 (GRCm38) missense possibly damaging 0.46
IGL03046:Pkhd1 UTSW 1 20,537,365 (GRCm38) missense possibly damaging 0.81
LCD18:Pkhd1 UTSW 1 20,611,414 (GRCm38) intron probably benign
P0035:Pkhd1 UTSW 1 20,117,347 (GRCm38) missense probably benign 0.00
PIT4260001:Pkhd1 UTSW 1 20,222,906 (GRCm38) missense possibly damaging 0.51
R0063:Pkhd1 UTSW 1 20,211,950 (GRCm38) missense probably benign 0.02
R0063:Pkhd1 UTSW 1 20,211,950 (GRCm38) missense probably benign 0.02
R0071:Pkhd1 UTSW 1 20,201,344 (GRCm38) missense probably benign 0.11
R0071:Pkhd1 UTSW 1 20,201,344 (GRCm38) missense probably benign 0.11
R0094:Pkhd1 UTSW 1 20,209,246 (GRCm38) missense probably damaging 1.00
R0094:Pkhd1 UTSW 1 20,209,246 (GRCm38) missense probably damaging 1.00
R0103:Pkhd1 UTSW 1 20,523,359 (GRCm38) missense probably benign 0.04
R0103:Pkhd1 UTSW 1 20,523,359 (GRCm38) missense probably benign 0.04
R0105:Pkhd1 UTSW 1 20,523,732 (GRCm38) nonsense probably null
R0105:Pkhd1 UTSW 1 20,523,732 (GRCm38) nonsense probably null
R0115:Pkhd1 UTSW 1 20,350,490 (GRCm38) missense probably damaging 1.00
R0193:Pkhd1 UTSW 1 20,358,917 (GRCm38) missense probably damaging 1.00
R0245:Pkhd1 UTSW 1 20,540,400 (GRCm38) missense probably benign 0.03
R0277:Pkhd1 UTSW 1 20,275,538 (GRCm38) missense probably benign 0.04
R0310:Pkhd1 UTSW 1 20,549,822 (GRCm38) splice site probably null
R0323:Pkhd1 UTSW 1 20,275,538 (GRCm38) missense probably benign 0.04
R0395:Pkhd1 UTSW 1 20,381,547 (GRCm38) missense probably benign 0.26
R0412:Pkhd1 UTSW 1 20,117,788 (GRCm38) missense probably damaging 1.00
R0506:Pkhd1 UTSW 1 20,559,469 (GRCm38) missense probably benign 0.00
R0512:Pkhd1 UTSW 1 20,310,514 (GRCm38) splice site probably benign
R0550:Pkhd1 UTSW 1 20,347,223 (GRCm38) missense probably null 1.00
R0584:Pkhd1 UTSW 1 20,239,436 (GRCm38) nonsense probably null
R0586:Pkhd1 UTSW 1 20,524,111 (GRCm38) missense probably benign 0.04
R0598:Pkhd1 UTSW 1 20,200,890 (GRCm38) missense probably damaging 1.00
R0603:Pkhd1 UTSW 1 20,117,173 (GRCm38) missense probably benign 0.05
R0634:Pkhd1 UTSW 1 20,117,474 (GRCm38) missense probably damaging 1.00
R0677:Pkhd1 UTSW 1 20,524,230 (GRCm38) missense probably benign 0.01
R0746:Pkhd1 UTSW 1 20,198,107 (GRCm38) missense probably damaging 1.00
R0781:Pkhd1 UTSW 1 20,117,484 (GRCm38) missense probably benign 0.01
R0840:Pkhd1 UTSW 1 20,350,521 (GRCm38) missense probably damaging 0.98
R0946:Pkhd1 UTSW 1 20,199,381 (GRCm38) missense probably benign 0.10
R1018:Pkhd1 UTSW 1 20,201,259 (GRCm38) missense possibly damaging 0.89
R1028:Pkhd1 UTSW 1 20,117,726 (GRCm38) missense probably damaging 1.00
R1136:Pkhd1 UTSW 1 20,522,829 (GRCm38) missense possibly damaging 0.68
R1178:Pkhd1 UTSW 1 20,585,157 (GRCm38) critical splice donor site probably null
R1180:Pkhd1 UTSW 1 20,585,157 (GRCm38) critical splice donor site probably null
R1222:Pkhd1 UTSW 1 20,567,456 (GRCm38) missense probably benign 0.07
R1334:Pkhd1 UTSW 1 20,533,905 (GRCm38) missense possibly damaging 0.81
R1335:Pkhd1 UTSW 1 20,571,405 (GRCm38) missense probably damaging 1.00
R1387:Pkhd1 UTSW 1 20,555,223 (GRCm38) splice site probably benign
R1411:Pkhd1 UTSW 1 20,373,896 (GRCm38) missense probably damaging 1.00
R1443:Pkhd1 UTSW 1 20,534,558 (GRCm38) missense probably damaging 1.00
R1448:Pkhd1 UTSW 1 20,585,157 (GRCm38) critical splice donor site probably null
R1468:Pkhd1 UTSW 1 20,523,341 (GRCm38) missense probably damaging 1.00
R1468:Pkhd1 UTSW 1 20,523,341 (GRCm38) missense probably damaging 1.00
R1473:Pkhd1 UTSW 1 20,522,983 (GRCm38) missense probably benign 0.00
R1524:Pkhd1 UTSW 1 20,117,780 (GRCm38) missense probably damaging 1.00
R1532:Pkhd1 UTSW 1 20,117,401 (GRCm38) missense probably benign 0.08
R1565:Pkhd1 UTSW 1 20,347,457 (GRCm38) missense probably damaging 1.00
R1572:Pkhd1 UTSW 1 20,347,440 (GRCm38) missense probably benign 0.02
R1583:Pkhd1 UTSW 1 20,117,825 (GRCm38) missense probably benign
R1617:Pkhd1 UTSW 1 20,198,050 (GRCm38) missense possibly damaging 0.95
R1631:Pkhd1 UTSW 1 20,522,897 (GRCm38) missense probably benign 0.06
R1655:Pkhd1 UTSW 1 20,584,129 (GRCm38) missense probably damaging 1.00
R1707:Pkhd1 UTSW 1 20,550,840 (GRCm38) splice site probably benign
R1753:Pkhd1 UTSW 1 20,533,905 (GRCm38) missense possibly damaging 0.81
R1782:Pkhd1 UTSW 1 20,565,711 (GRCm38) missense probably damaging 0.98
R1791:Pkhd1 UTSW 1 20,585,152 (GRCm38) splice site probably benign
R1822:Pkhd1 UTSW 1 20,347,457 (GRCm38) missense probably damaging 1.00
R1823:Pkhd1 UTSW 1 20,347,457 (GRCm38) missense probably damaging 1.00
R1824:Pkhd1 UTSW 1 20,347,457 (GRCm38) missense probably damaging 1.00
R1836:Pkhd1 UTSW 1 20,117,069 (GRCm38) missense probably benign 0.01
R1862:Pkhd1 UTSW 1 20,551,020 (GRCm38) missense probably benign 0.00
R1863:Pkhd1 UTSW 1 20,551,020 (GRCm38) missense probably benign 0.00
R1869:Pkhd1 UTSW 1 20,615,267 (GRCm38) critical splice donor site probably null
R1913:Pkhd1 UTSW 1 20,566,756 (GRCm38) critical splice donor site probably null
R1928:Pkhd1 UTSW 1 20,081,300 (GRCm38) splice site probably benign
R1969:Pkhd1 UTSW 1 20,381,523 (GRCm38) missense probably damaging 1.00
R1970:Pkhd1 UTSW 1 20,381,523 (GRCm38) missense probably damaging 1.00
R1981:Pkhd1 UTSW 1 20,117,060 (GRCm38) missense probably benign 0.00
R2008:Pkhd1 UTSW 1 20,199,459 (GRCm38) missense probably damaging 0.99
R2034:Pkhd1 UTSW 1 20,200,669 (GRCm38) missense probably damaging 1.00
R2061:Pkhd1 UTSW 1 20,612,812 (GRCm38) missense possibly damaging 0.76
R2062:Pkhd1 UTSW 1 20,201,335 (GRCm38) missense probably damaging 0.97
R2108:Pkhd1 UTSW 1 20,553,574 (GRCm38) nonsense probably null
R2142:Pkhd1 UTSW 1 20,523,895 (GRCm38) missense probably benign 0.00
R2148:Pkhd1 UTSW 1 20,414,220 (GRCm38) critical splice donor site probably null
R2176:Pkhd1 UTSW 1 20,553,517 (GRCm38) missense probably damaging 1.00
R2202:Pkhd1 UTSW 1 20,537,360 (GRCm38) missense probably benign 0.06
R2255:Pkhd1 UTSW 1 20,565,639 (GRCm38) missense probably benign 0.23
R2269:Pkhd1 UTSW 1 20,534,535 (GRCm38) critical splice donor site probably null
R2275:Pkhd1 UTSW 1 20,200,849 (GRCm38) missense possibly damaging 0.95
R2340:Pkhd1 UTSW 1 20,200,855 (GRCm38) missense probably damaging 1.00
R2431:Pkhd1 UTSW 1 20,201,165 (GRCm38) missense possibly damaging 0.63
R2679:Pkhd1 UTSW 1 20,209,182 (GRCm38) missense probably benign 0.03
R2850:Pkhd1 UTSW 1 20,509,076 (GRCm38) missense possibly damaging 0.89
R2851:Pkhd1 UTSW 1 20,058,302 (GRCm38) missense probably benign 0.16
R2853:Pkhd1 UTSW 1 20,058,302 (GRCm38) missense probably benign 0.16
R2984:Pkhd1 UTSW 1 20,222,961 (GRCm38) missense possibly damaging 0.84
R2987:Pkhd1 UTSW 1 20,104,599 (GRCm38) missense possibly damaging 0.87
R3692:Pkhd1 UTSW 1 20,555,129 (GRCm38) missense possibly damaging 0.87
R3746:Pkhd1 UTSW 1 20,058,300 (GRCm38) makesense probably null
R3838:Pkhd1 UTSW 1 20,534,629 (GRCm38) missense possibly damaging 0.66
R3843:Pkhd1 UTSW 1 20,558,723 (GRCm38) missense probably benign 0.00
R3861:Pkhd1 UTSW 1 20,200,927 (GRCm38) missense probably damaging 1.00
R3893:Pkhd1 UTSW 1 20,312,138 (GRCm38) nonsense probably null
R3926:Pkhd1 UTSW 1 20,550,873 (GRCm38) missense probably benign 0.00
R4183:Pkhd1 UTSW 1 20,117,807 (GRCm38) missense probably benign 0.03
R4184:Pkhd1 UTSW 1 20,563,686 (GRCm38) missense probably benign 0.06
R4184:Pkhd1 UTSW 1 20,209,277 (GRCm38) missense probably benign 0.03
R4255:Pkhd1 UTSW 1 20,593,934 (GRCm38) missense probably damaging 0.99
R4275:Pkhd1 UTSW 1 20,058,384 (GRCm38) missense probably benign 0.00
R4342:Pkhd1 UTSW 1 20,058,617 (GRCm38) missense probably benign 0.00
R4386:Pkhd1 UTSW 1 20,414,292 (GRCm38) missense probably benign 0.00
R4402:Pkhd1 UTSW 1 20,239,411 (GRCm38) missense probably damaging 1.00
R4431:Pkhd1 UTSW 1 20,523,314 (GRCm38) missense probably damaging 0.99
R4560:Pkhd1 UTSW 1 20,211,858 (GRCm38) missense probably damaging 1.00
R4561:Pkhd1 UTSW 1 20,534,719 (GRCm38) missense possibly damaging 0.89
R4570:Pkhd1 UTSW 1 20,381,523 (GRCm38) missense probably damaging 1.00
R4571:Pkhd1 UTSW 1 20,613,409 (GRCm38) missense probably damaging 1.00
R4588:Pkhd1 UTSW 1 20,200,868 (GRCm38) missense probably benign 0.00
R4598:Pkhd1 UTSW 1 20,503,056 (GRCm38) missense probably damaging 1.00
R4651:Pkhd1 UTSW 1 20,381,523 (GRCm38) missense probably damaging 1.00
R4657:Pkhd1 UTSW 1 20,364,167 (GRCm38) missense possibly damaging 0.89
R4718:Pkhd1 UTSW 1 20,081,228 (GRCm38) missense probably damaging 1.00
R4740:Pkhd1 UTSW 1 20,524,130 (GRCm38) missense probably benign
R4750:Pkhd1 UTSW 1 20,524,112 (GRCm38) missense possibly damaging 0.57
R4816:Pkhd1 UTSW 1 20,199,415 (GRCm38) missense probably damaging 0.99
R4825:Pkhd1 UTSW 1 20,537,401 (GRCm38) missense probably damaging 0.96
R4885:Pkhd1 UTSW 1 20,070,488 (GRCm38) missense possibly damaging 0.55
R4907:Pkhd1 UTSW 1 20,209,226 (GRCm38) missense probably damaging 1.00
R4944:Pkhd1 UTSW 1 20,288,205 (GRCm38) missense probably null 0.01
R5062:Pkhd1 UTSW 1 20,585,711 (GRCm38) missense probably benign 0.00
R5090:Pkhd1 UTSW 1 20,200,757 (GRCm38) missense probably damaging 1.00
R5104:Pkhd1 UTSW 1 20,585,191 (GRCm38) missense probably damaging 1.00
R5187:Pkhd1 UTSW 1 20,209,224 (GRCm38) missense possibly damaging 0.67
R5202:Pkhd1 UTSW 1 20,547,341 (GRCm38) missense probably benign 0.01
R5240:Pkhd1 UTSW 1 20,275,641 (GRCm38) missense probably benign 0.04
R5248:Pkhd1 UTSW 1 20,534,545 (GRCm38) missense probably benign 0.00
R5252:Pkhd1 UTSW 1 20,350,411 (GRCm38) critical splice donor site probably null
R5293:Pkhd1 UTSW 1 20,509,076 (GRCm38) missense possibly damaging 0.89
R5311:Pkhd1 UTSW 1 20,565,870 (GRCm38) missense possibly damaging 0.94
R5317:Pkhd1 UTSW 1 20,450,304 (GRCm38) missense probably damaging 1.00
R5346:Pkhd1 UTSW 1 20,523,434 (GRCm38) missense probably damaging 0.96
R5346:Pkhd1 UTSW 1 20,392,097 (GRCm38) missense probably benign
R5431:Pkhd1 UTSW 1 20,117,836 (GRCm38) missense probably benign 0.25
R5447:Pkhd1 UTSW 1 20,239,385 (GRCm38) missense probably benign 0.00
R5478:Pkhd1 UTSW 1 20,201,156 (GRCm38) missense probably damaging 1.00
R5497:Pkhd1 UTSW 1 20,377,404 (GRCm38) missense possibly damaging 0.94
R5554:Pkhd1 UTSW 1 20,081,252 (GRCm38) missense probably damaging 0.99
R5579:Pkhd1 UTSW 1 20,523,142 (GRCm38) missense probably damaging 0.96
R5614:Pkhd1 UTSW 1 20,073,526 (GRCm38) missense possibly damaging 0.83
R5648:Pkhd1 UTSW 1 20,558,626 (GRCm38) missense probably benign 0.04
R5651:Pkhd1 UTSW 1 20,117,807 (GRCm38) missense probably benign 0.03
R5665:Pkhd1 UTSW 1 20,588,531 (GRCm38) missense probably damaging 1.00
R5681:Pkhd1 UTSW 1 20,547,461 (GRCm38) missense possibly damaging 0.61
R5754:Pkhd1 UTSW 1 20,523,651 (GRCm38) nonsense probably null
R5760:Pkhd1 UTSW 1 20,073,554 (GRCm38) missense probably benign 0.02
R5776:Pkhd1 UTSW 1 20,209,185 (GRCm38) missense possibly damaging 0.62
R5782:Pkhd1 UTSW 1 20,058,600 (GRCm38) missense probably benign
R5810:Pkhd1 UTSW 1 20,200,673 (GRCm38) missense probably benign 0.26
R5814:Pkhd1 UTSW 1 20,199,405 (GRCm38) missense probably damaging 1.00
R5816:Pkhd1 UTSW 1 20,058,678 (GRCm38) missense probably benign 0.03
R5835:Pkhd1 UTSW 1 20,201,083 (GRCm38) missense probably benign 0.01
R5844:Pkhd1 UTSW 1 20,381,461 (GRCm38) missense probably benign 0.00
R5847:Pkhd1 UTSW 1 20,374,736 (GRCm38) nonsense probably null
R5852:Pkhd1 UTSW 1 20,377,408 (GRCm38) missense probably benign 0.22
R5863:Pkhd1 UTSW 1 20,520,210 (GRCm38) missense possibly damaging 0.63
R6213:Pkhd1 UTSW 1 20,523,770 (GRCm38) missense possibly damaging 0.80
R6351:Pkhd1 UTSW 1 20,211,951 (GRCm38) missense probably benign 0.00
R6386:Pkhd1 UTSW 1 20,551,020 (GRCm38) missense probably damaging 0.96
R6542:Pkhd1 UTSW 1 20,585,703 (GRCm38) missense probably benign 0.02
R6579:Pkhd1 UTSW 1 20,200,823 (GRCm38) missense probably benign 0.01
R6658:Pkhd1 UTSW 1 20,612,705 (GRCm38) missense probably damaging 1.00
R6765:Pkhd1 UTSW 1 20,058,339 (GRCm38) missense probably benign
R6886:Pkhd1 UTSW 1 20,347,280 (GRCm38) missense probably benign 0.01
R6892:Pkhd1 UTSW 1 20,523,515 (GRCm38) missense probably damaging 1.00
R6900:Pkhd1 UTSW 1 20,534,701 (GRCm38) missense probably benign 0.06
R6932:Pkhd1 UTSW 1 20,562,451 (GRCm38) missense probably benign 0.19
R7191:Pkhd1 UTSW 1 20,558,719 (GRCm38) missense probably benign 0.00
R7220:Pkhd1 UTSW 1 20,523,126 (GRCm38) missense possibly damaging 0.89
R7329:Pkhd1 UTSW 1 20,547,519 (GRCm38) missense probably damaging 0.96
R7361:Pkhd1 UTSW 1 20,593,953 (GRCm38) missense probably damaging 1.00
R7381:Pkhd1 UTSW 1 20,200,973 (GRCm38) missense probably damaging 1.00
R7388:Pkhd1 UTSW 1 20,239,304 (GRCm38) missense not run
R7436:Pkhd1 UTSW 1 20,200,701 (GRCm38) missense probably benign
R7473:Pkhd1 UTSW 1 20,549,756 (GRCm38) missense probably damaging 0.99
R7578:Pkhd1 UTSW 1 20,347,361 (GRCm38) missense probably damaging 1.00
R7751:Pkhd1 UTSW 1 20,200,925 (GRCm38) missense probably damaging 1.00
R7755:Pkhd1 UTSW 1 20,547,493 (GRCm38) missense probably damaging 0.98
R7757:Pkhd1 UTSW 1 20,562,415 (GRCm38) missense probably damaging 1.00
R7832:Pkhd1 UTSW 1 20,502,999 (GRCm38) missense probably damaging 1.00
R7834:Pkhd1 UTSW 1 20,312,049 (GRCm38) missense probably benign
R7920:Pkhd1 UTSW 1 20,275,535 (GRCm38) missense probably damaging 1.00
R8014:Pkhd1 UTSW 1 20,508,891 (GRCm38) critical splice donor site probably null
R8034:Pkhd1 UTSW 1 20,381,438 (GRCm38) missense possibly damaging 0.94
R8085:Pkhd1 UTSW 1 20,613,415 (GRCm38) missense probably damaging 1.00
R8087:Pkhd1 UTSW 1 20,523,089 (GRCm38) missense probably damaging 1.00
R8103:Pkhd1 UTSW 1 20,200,757 (GRCm38) missense probably damaging 1.00
R8122:Pkhd1 UTSW 1 20,562,458 (GRCm38) missense probably damaging 1.00
R8273:Pkhd1 UTSW 1 20,537,420 (GRCm38) splice site probably benign
R8485:Pkhd1 UTSW 1 20,523,033 (GRCm38) missense probably damaging 1.00
R8504:Pkhd1 UTSW 1 20,520,208 (GRCm38) missense probably benign 0.10
R8544:Pkhd1 UTSW 1 20,522,975 (GRCm38) missense probably damaging 1.00
R8692:Pkhd1 UTSW 1 20,392,150 (GRCm38) missense probably damaging 1.00
R8787:Pkhd1 UTSW 1 20,288,237 (GRCm38) missense probably damaging 0.99
R8853:Pkhd1 UTSW 1 20,073,455 (GRCm38) critical splice donor site probably null
R8907:Pkhd1 UTSW 1 20,117,561 (GRCm38) missense possibly damaging 0.88
R8934:Pkhd1 UTSW 1 20,392,010 (GRCm38) critical splice donor site probably null
R8990:Pkhd1 UTSW 1 20,347,305 (GRCm38) missense probably benign 0.00
R8998:Pkhd1 UTSW 1 20,364,201 (GRCm38) missense probably damaging 1.00
R9024:Pkhd1 UTSW 1 20,522,751 (GRCm38) missense probably benign 0.24
R9035:Pkhd1 UTSW 1 20,502,952 (GRCm38) missense probably damaging 1.00
R9092:Pkhd1 UTSW 1 20,562,362 (GRCm38) missense probably benign 0.00
R9238:Pkhd1 UTSW 1 20,534,575 (GRCm38) missense possibly damaging 0.89
R9258:Pkhd1 UTSW 1 20,373,950 (GRCm38) missense probably damaging 0.99
R9262:Pkhd1 UTSW 1 20,548,127 (GRCm38) missense probably benign 0.01
R9297:Pkhd1 UTSW 1 20,222,894 (GRCm38) missense probably benign 0.06
R9452:Pkhd1 UTSW 1 20,612,729 (GRCm38) missense possibly damaging 0.77
R9515:Pkhd1 UTSW 1 20,567,517 (GRCm38) missense probably damaging 1.00
R9540:Pkhd1 UTSW 1 20,199,346 (GRCm38) missense probably benign 0.00
R9542:Pkhd1 UTSW 1 20,117,780 (GRCm38) missense probably damaging 1.00
R9629:Pkhd1 UTSW 1 20,392,213 (GRCm38) missense possibly damaging 0.63
R9644:Pkhd1 UTSW 1 20,547,466 (GRCm38) missense probably benign 0.04
R9739:Pkhd1 UTSW 1 20,350,484 (GRCm38) missense probably damaging 1.00
R9767:Pkhd1 UTSW 1 20,414,412 (GRCm38) missense probably benign
R9781:Pkhd1 UTSW 1 20,117,441 (GRCm38) missense possibly damaging 0.95
R9803:Pkhd1 UTSW 1 20,566,849 (GRCm38) missense probably damaging 1.00
X0012:Pkhd1 UTSW 1 20,373,926 (GRCm38) missense probably damaging 1.00
X0067:Pkhd1 UTSW 1 20,520,226 (GRCm38) missense probably damaging 1.00
Z1176:Pkhd1 UTSW 1 20,523,747 (GRCm38) missense possibly damaging 0.81
Z1177:Pkhd1 UTSW 1 20,523,621 (GRCm38) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,310,594 (GRCm38) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,117,883 (GRCm38) missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20,551,019 (GRCm38) missense probably benign
Z1177:Pkhd1 UTSW 1 20,523,938 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACACACTGGTTGATATTGTCAGC -3'
(R):5'- CAGTATGTATCAGTTTCCTCTGGCC -3'

Sequencing Primer
(F):5'- CTGGTTGATATTGTCAGCATGATCAC -3'
(R):5'- GGCCAATTTGACTTCTATACATTGG -3'
Posted On 2015-01-23