Incidental Mutation 'R3721:Slc2a2'
ID258889
Institutional Source Beutler Lab
Gene Symbol Slc2a2
Ensembl Gene ENSMUSG00000027690
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 2
SynonymsGlut2, liver-type glucose transporter, Glut-2
MMRRC Submission 040712-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3721 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location28697903-28731359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28727152 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 446 (N446K)
Ref Sequence ENSEMBL: ENSMUSP00000029240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029240] [ENSMUST00000163536]
Predicted Effect probably damaging
Transcript: ENSMUST00000029240
AA Change: N446K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029240
Gene: ENSMUSG00000027690
AA Change: N446K

DomainStartEndE-ValueType
Pfam:MFS_1 9 442 4.2e-23 PFAM
Pfam:Sugar_tr 13 498 2.4e-165 PFAM
Pfam:Folate_carrier 187 458 5.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163536
SMART Domains Protein: ENSMUSP00000131046
Gene: ENSMUSG00000027690

DomainStartEndE-ValueType
Pfam:Sugar_tr 13 133 3.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169047
Meta Mutation Damage Score 0.5520 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral plasma membrane glycoprotein of the liver, islet beta cells, intestine, and kidney epithelium. The encoded protein mediates facilitated bidirectional glucose transport. Because of its low affinity for glucose, it has been suggested as a glucose sensor. Mutations in this gene are associated with susceptibility to diseases, including Fanconi-Bickel syndrome and noninsulin-dependent diabetes mellitus (NIDDM). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice are hyperglycemic with hypoinsulinemia and die within 2-3 weeks of life displaying increased plasma levels of glucagon, free fatty acids and beta-hydroxybutyrate, abnormal glucose tolerance, and altered postnatal development of pancreatic islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a T C 2: 48,892,138 S228P probably damaging Het
Adamts2 C T 11: 50,773,211 probably benign Het
Arhgap9 A G 10: 127,328,971 E588G possibly damaging Het
Ash2l C G 8: 25,818,625 G453A probably damaging Het
Catsperg2 A G 7: 29,705,102 V638A probably benign Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cdc73 T C 1: 143,695,453 I83V possibly damaging Het
Clec2e C A 6: 129,094,410 E155* probably null Het
Cyp3a59 T A 5: 146,096,597 M181K probably damaging Het
Dars2 A T 1: 161,063,308 V111E probably benign Het
Diras2 T A 13: 52,508,023 I83F probably damaging Het
Dlg2 T A 7: 91,711,800 probably null Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Emilin2 T C 17: 71,273,454 N759S probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fam102b C T 3: 108,979,767 R305Q probably damaging Het
Ggnbp1 T C 17: 27,029,613 V52A probably benign Het
Gm5155 A G 7: 17,902,738 T247A probably benign Het
Gpr171 A G 3: 59,097,670 V228A possibly damaging Het
Gsta3 T C 1: 21,260,089 M55T probably benign Het
Hectd3 T A 4: 116,999,745 N496K probably benign Het
Hp1bp3 T G 4: 138,239,608 F367V probably damaging Het
Il18rap T A 1: 40,537,088 L253Q probably damaging Het
Irs1 C T 1: 82,290,085 G137S probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lair1 A C 7: 4,010,783 L155R probably damaging Het
Larp7 A G 3: 127,546,811 L126P probably damaging Het
Lhx1 G A 11: 84,521,828 R89C probably damaging Het
Lypd4 C A 7: 24,865,459 A85S probably benign Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myh10 G T 11: 68,813,052 R1863L probably damaging Het
Myo9a G A 9: 59,868,180 V1025I probably benign Het
Naa25 T A 5: 121,431,556 D659E probably benign Het
Nol9 A G 4: 152,039,706 S118G probably benign Het
Olfr497 G T 7: 108,423,119 D183Y probably damaging Het
Olfr730 C T 14: 50,186,680 C179Y probably damaging Het
Pde10a T A 17: 8,969,589 I907N probably damaging Het
Pkhd1 T C 1: 20,585,655 D218G probably benign Het
Poll A G 19: 45,553,577 I430T probably damaging Het
Pomgnt1 T G 4: 116,153,543 probably benign Het
Rab6b T C 9: 103,167,174 probably null Het
Rad1 T C 15: 10,488,026 S79P probably benign Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Rcc1 T C 4: 132,337,814 K133E possibly damaging Het
Ric8a T C 7: 140,861,961 probably null Het
Rnf135 G T 11: 80,196,917 A231S probably benign Het
Rps6ka4 A G 19: 6,839,277 V146A possibly damaging Het
Sh3bp4 A G 1: 89,145,328 I633V possibly damaging Het
Slc44a1 T C 4: 53,491,445 Y61H probably damaging Het
Slc7a1 G A 5: 148,335,533 R445* probably null Het
Smc5 T C 19: 23,210,492 M911V probably benign Het
Sntb1 C A 15: 55,642,818 R453L probably benign Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Srrm2 CTCCTCTTCTTCCTCTTCTTCCTC CTCCTCTTCTTCCTC 17: 23,822,575 probably benign Het
Trpm1 T G 7: 64,217,727 probably benign Het
Tufm T C 7: 126,490,460 M442T probably benign Het
Ubn1 A G 16: 5,073,378 N539S possibly damaging Het
Other mutations in Slc2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Slc2a2 APN 3 28718741 missense possibly damaging 0.86
IGL01582:Slc2a2 APN 3 28708488 missense probably benign 0.01
IGL01762:Slc2a2 APN 3 28717472 missense probably damaging 1.00
IGL01942:Slc2a2 APN 3 28705803 missense probably damaging 1.00
IGL02128:Slc2a2 APN 3 28719401 missense probably damaging 1.00
IGL02218:Slc2a2 APN 3 28698025 missense possibly damaging 0.94
IGL02278:Slc2a2 APN 3 28717455 missense probably damaging 0.99
IGL02507:Slc2a2 APN 3 28727111 missense probably benign 0.00
IGL02649:Slc2a2 APN 3 28718736 missense probably damaging 0.97
IGL03323:Slc2a2 APN 3 28726290 missense probably damaging 1.00
IGL03147:Slc2a2 UTSW 3 28719370 missense possibly damaging 0.56
R0063:Slc2a2 UTSW 3 28717440 missense probably damaging 0.98
R0063:Slc2a2 UTSW 3 28717440 missense probably damaging 0.98
R0365:Slc2a2 UTSW 3 28708679 critical splice donor site probably null
R0494:Slc2a2 UTSW 3 28727277 missense probably benign 0.01
R0519:Slc2a2 UTSW 3 28718816 missense possibly damaging 0.54
R1292:Slc2a2 UTSW 3 28717488 missense probably damaging 1.00
R1755:Slc2a2 UTSW 3 28713662 intron probably null
R1965:Slc2a2 UTSW 3 28719485 missense probably damaging 1.00
R1966:Slc2a2 UTSW 3 28719485 missense probably damaging 1.00
R1982:Slc2a2 UTSW 3 28717441 missense probably benign 0.36
R2937:Slc2a2 UTSW 3 28718771 missense probably damaging 1.00
R3121:Slc2a2 UTSW 3 28721749 missense probably benign 0.01
R4799:Slc2a2 UTSW 3 28717532 critical splice donor site probably null
R5206:Slc2a2 UTSW 3 28708607 missense probably damaging 1.00
R6829:Slc2a2 UTSW 3 28727441 nonsense probably null
R6864:Slc2a2 UTSW 3 28721725 missense probably damaging 1.00
R6932:Slc2a2 UTSW 3 28717519 missense probably benign 0.40
R7178:Slc2a2 UTSW 3 28719482 missense possibly damaging 0.90
R7599:Slc2a2 UTSW 3 28698017 start codon destroyed probably null 0.02
R7616:Slc2a2 UTSW 3 28727111 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGGATAAATTCGCCTGGATGAG -3'
(R):5'- TCTTCCGGAATTCTGCAGCG -3'

Sequencing Primer
(F):5'- AAATTCGCCTGGATGAGTTACG -3'
(R):5'- TCTGCAGCGATTTCCTCAAAAG -3'
Posted On2015-01-23