Incidental Mutation 'R3721:Hectd3'
ID 258899
Institutional Source Beutler Lab
Gene Symbol Hectd3
Ensembl Gene ENSMUSG00000046861
Gene Name HECT domain E3 ubiquitin protein ligase 3
Synonyms 1700064K09Rik
MMRRC Submission 040712-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3721 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 116995317-117005277 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 116999745 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 496 (N496K)
Ref Sequence ENSEMBL: ENSMUSP00000051922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050067]
AlphaFold Q3U487
Predicted Effect probably benign
Transcript: ENSMUST00000050067
AA Change: N496K

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000051922
Gene: ENSMUSG00000046861
AA Change: N496K

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
APC10 237 391 6.75e-23 SMART
HECTc 514 857 1.27e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155267
Meta Mutation Damage Score 0.1055 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene transfers ubiquitin from an E2 ubiquitin-conjugating enzyme to targeted substrates, leading to the degradation of those substrates. The encoded protein has been shown to transfer ubiquitin to TRIOBP to facilitate cell cycle progression, and to STX8. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a T C 2: 48,892,138 S228P probably damaging Het
Adamts2 C T 11: 50,773,211 probably benign Het
Arhgap9 A G 10: 127,328,971 E588G possibly damaging Het
Ash2l C G 8: 25,818,625 G453A probably damaging Het
Catsperg2 A G 7: 29,705,102 V638A probably benign Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cdc73 T C 1: 143,695,453 I83V possibly damaging Het
Clec2e C A 6: 129,094,410 E155* probably null Het
Cyp3a59 T A 5: 146,096,597 M181K probably damaging Het
Dars2 A T 1: 161,063,308 V111E probably benign Het
Diras2 T A 13: 52,508,023 I83F probably damaging Het
Dlg2 T A 7: 91,711,800 probably null Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Emilin2 T C 17: 71,273,454 N759S probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fam102b C T 3: 108,979,767 R305Q probably damaging Het
Ggnbp1 T C 17: 27,029,613 V52A probably benign Het
Gm5155 A G 7: 17,902,738 T247A probably benign Het
Gpr171 A G 3: 59,097,670 V228A possibly damaging Het
Gsta3 T C 1: 21,260,089 M55T probably benign Het
Hp1bp3 T G 4: 138,239,608 F367V probably damaging Het
Il18rap T A 1: 40,537,088 L253Q probably damaging Het
Irs1 C T 1: 82,290,085 G137S probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lair1 A C 7: 4,010,783 L155R probably damaging Het
Larp7 A G 3: 127,546,811 L126P probably damaging Het
Lhx1 G A 11: 84,521,828 R89C probably damaging Het
Lypd4 C A 7: 24,865,459 A85S probably benign Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myh10 G T 11: 68,813,052 R1863L probably damaging Het
Myo9a G A 9: 59,868,180 V1025I probably benign Het
Naa25 T A 5: 121,431,556 D659E probably benign Het
Nol9 A G 4: 152,039,706 S118G probably benign Het
Olfr497 G T 7: 108,423,119 D183Y probably damaging Het
Olfr730 C T 14: 50,186,680 C179Y probably damaging Het
Pde10a T A 17: 8,969,589 I907N probably damaging Het
Pkhd1 T C 1: 20,585,655 D218G probably benign Het
Poll A G 19: 45,553,577 I430T probably damaging Het
Pomgnt1 T G 4: 116,153,543 probably benign Het
Rab6b T C 9: 103,167,174 probably null Het
Rad1 T C 15: 10,488,026 S79P probably benign Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Rcc1 T C 4: 132,337,814 K133E possibly damaging Het
Ric8a T C 7: 140,861,961 probably null Het
Rnf135 G T 11: 80,196,917 A231S probably benign Het
Rps6ka4 A G 19: 6,839,277 V146A possibly damaging Het
Sh3bp4 A G 1: 89,145,328 I633V possibly damaging Het
Slc2a2 T A 3: 28,727,152 N446K probably damaging Het
Slc44a1 T C 4: 53,491,445 Y61H probably damaging Het
Slc7a1 G A 5: 148,335,533 R445* probably null Het
Smc5 T C 19: 23,210,492 M911V probably benign Het
Sntb1 C A 15: 55,642,818 R453L probably benign Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Srrm2 CTCCTCTTCTTCCTCTTCTTCCTC CTCCTCTTCTTCCTC 17: 23,822,575 probably benign Het
Trpm1 T G 7: 64,217,727 probably benign Het
Tufm T C 7: 126,490,460 M442T probably benign Het
Ubn1 A G 16: 5,073,378 N539S possibly damaging Het
Other mutations in Hectd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Hectd3 APN 4 117000588 splice site probably benign
IGL00227:Hectd3 APN 4 117000587 splice site probably benign
IGL00227:Hectd3 APN 4 117000589 splice site probably benign
IGL00987:Hectd3 APN 4 116999643 missense probably damaging 0.98
IGL01402:Hectd3 APN 4 116996065 missense probably damaging 0.96
IGL01660:Hectd3 APN 4 116996372 missense possibly damaging 0.91
IGL02397:Hectd3 APN 4 117003136 missense possibly damaging 0.94
IGL03029:Hectd3 APN 4 116996965 nonsense probably null
chopstix2 UTSW 4 116996396 missense probably benign 0.08
R0147:Hectd3 UTSW 4 116997040 unclassified probably benign
R0240:Hectd3 UTSW 4 117002613 missense probably damaging 0.97
R0240:Hectd3 UTSW 4 117002613 missense probably damaging 0.97
R0611:Hectd3 UTSW 4 116996044 missense possibly damaging 0.67
R1367:Hectd3 UTSW 4 116997170 missense probably null 0.48
R1401:Hectd3 UTSW 4 117002269 missense possibly damaging 0.52
R1444:Hectd3 UTSW 4 116996396 missense probably benign 0.08
R1466:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1466:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1517:Hectd3 UTSW 4 117002994 missense probably damaging 0.96
R1584:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1593:Hectd3 UTSW 4 116997020 missense possibly damaging 0.86
R1628:Hectd3 UTSW 4 116997392 missense probably damaging 1.00
R1669:Hectd3 UTSW 4 116999643 missense probably damaging 0.98
R1731:Hectd3 UTSW 4 116996455 critical splice donor site probably null
R1918:Hectd3 UTSW 4 117000343 missense possibly damaging 0.68
R2029:Hectd3 UTSW 4 117000685 missense probably damaging 0.99
R2174:Hectd3 UTSW 4 116999701 missense probably benign 0.04
R2184:Hectd3 UTSW 4 117000903 missense possibly damaging 0.93
R2226:Hectd3 UTSW 4 116995689 missense possibly damaging 0.67
R3895:Hectd3 UTSW 4 116996089 missense probably damaging 1.00
R3937:Hectd3 UTSW 4 116998530 missense probably benign 0.28
R4291:Hectd3 UTSW 4 116995692 missense probably damaging 1.00
R4729:Hectd3 UTSW 4 116997218 missense probably damaging 0.98
R4837:Hectd3 UTSW 4 117002597 missense probably null 0.32
R5059:Hectd3 UTSW 4 116997164 missense possibly damaging 0.93
R5090:Hectd3 UTSW 4 117000238 splice site probably benign
R5910:Hectd3 UTSW 4 117002134 missense probably benign 0.09
R5932:Hectd3 UTSW 4 117002273 missense possibly damaging 0.79
R6182:Hectd3 UTSW 4 117000279 missense probably damaging 1.00
R6292:Hectd3 UTSW 4 116998808 missense probably damaging 1.00
R6405:Hectd3 UTSW 4 117000624 missense probably benign 0.04
R6478:Hectd3 UTSW 4 116999586 missense probably damaging 1.00
R7444:Hectd3 UTSW 4 116996927 missense possibly damaging 0.48
R7471:Hectd3 UTSW 4 116996588 missense probably benign 0.01
R8053:Hectd3 UTSW 4 117000858 missense possibly damaging 0.65
R8671:Hectd3 UTSW 4 116996581 missense possibly damaging 0.67
R8840:Hectd3 UTSW 4 116998407 missense probably benign 0.14
Z1177:Hectd3 UTSW 4 116998760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCGATTGCCCACTCATTC -3'
(R):5'- TAGTCCAAGGGCTTCTCATACTTG -3'

Sequencing Primer
(F):5'- CACCTTTCCTCCAGCAAGTG -3'
(R):5'- CATACTTGTCAGAAGGCTTGAGACC -3'
Posted On 2015-01-23