Incidental Mutation 'R0328:Helz'
ID25892
Institutional Source Beutler Lab
Gene Symbol Helz
Ensembl Gene ENSMUSG00000020721
Gene Namehelicase with zinc finger domain
Synonyms9630002H22Rik, 3110078M01Rik, 9430093I07Rik
MMRRC Submission 038537-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0328 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location107547930-107693826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 107604348 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 383 (A383S)
Ref Sequence ENSEMBL: ENSMUSP00000102357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075012] [ENSMUST00000100305] [ENSMUST00000106746]
Predicted Effect probably benign
Transcript: ENSMUST00000075012
AA Change: A383S

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074533
Gene: ENSMUSG00000020721
AA Change: A383S

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:ResIII 639 807 6.7e-8 PFAM
Pfam:AAA_11 641 768 2.3e-14 PFAM
Pfam:AAA_30 641 838 2.6e-11 PFAM
Pfam:AAA_19 648 729 5.5e-11 PFAM
Pfam:AAA_11 758 834 3.8e-18 PFAM
Pfam:AAA_12 841 1053 7.4e-38 PFAM
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1360 1448 N/A INTRINSIC
low complexity region 1466 1487 N/A INTRINSIC
low complexity region 1557 1568 N/A INTRINSIC
low complexity region 1631 1647 N/A INTRINSIC
low complexity region 1716 1736 N/A INTRINSIC
low complexity region 1926 1933 N/A INTRINSIC
low complexity region 1942 1957 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100305
AA Change: A383S

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097878
Gene: ENSMUSG00000020721
AA Change: A383S

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 2.7e-31 PFAM
Pfam:AAA_30 641 837 1.7e-10 PFAM
Pfam:AAA_19 648 727 6.3e-9 PFAM
Pfam:AAA_12 840 1052 3.4e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106746
AA Change: A383S

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102357
Gene: ENSMUSG00000020721
AA Change: A383S

DomainStartEndE-ValueType
SCOP:d1ihga1 6 84 5e-3 SMART
low complexity region 129 146 N/A INTRINSIC
ZnF_C3H1 178 205 2.61e-4 SMART
Pfam:AAA_11 641 833 1e-31 PFAM
Pfam:AAA_30 641 837 8.3e-11 PFAM
Pfam:AAA_19 648 727 2.2e-9 PFAM
Pfam:AAA_12 840 1052 1.7e-36 PFAM
low complexity region 1164 1175 N/A INTRINSIC
low complexity region 1359 1447 N/A INTRINSIC
low complexity region 1465 1486 N/A INTRINSIC
low complexity region 1556 1567 N/A INTRINSIC
low complexity region 1630 1646 N/A INTRINSIC
low complexity region 1715 1735 N/A INTRINSIC
low complexity region 1925 1932 N/A INTRINSIC
low complexity region 1941 1956 N/A INTRINSIC
Meta Mutation Damage Score 0.0907 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.5%
  • 20x: 90.8%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] HELZ is a member of the superfamily I class of RNA helicases. RNA helicases alter the conformation of RNA by unwinding double-stranded regions, thereby altering the biologic activity of the RNA molecule and regulating access to other proteins (Wagner et al., 1999 [PubMed 10471385]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene-trapped allele are viable, fertile and phenotypically normal with no apparent skeletal defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A T 2: 68,744,280 H618L possibly damaging Het
Aacs T C 5: 125,516,259 V642A probably benign Het
Alms1 A G 6: 85,610,814 probably null Het
Arhgap39 A G 15: 76,751,952 probably benign Het
Bard1 C T 1: 71,046,762 V595I probably benign Het
Bptf T C 11: 107,047,127 K2713E probably damaging Het
Calhm1 C T 19: 47,141,303 G260D possibly damaging Het
Ccdc154 A C 17: 25,171,805 K643T probably benign Het
Ccl4 T A 11: 83,663,557 S59T probably damaging Het
Cntd1 T C 11: 101,283,433 S73P probably benign Het
Colgalt2 A T 1: 152,473,108 D168V probably damaging Het
Fam117a T C 11: 95,375,626 probably benign Het
Fat1 A G 8: 45,023,790 T1935A probably benign Het
Fbxw21 T A 9: 109,146,585 I248F possibly damaging Het
Fhod3 A T 18: 25,113,600 M1288L probably benign Het
Gm5114 T G 7: 39,408,461 K578T probably damaging Het
Gxylt2 A T 6: 100,750,535 probably benign Het
Ift172 C A 5: 31,263,851 E968* probably null Het
Itpripl1 T C 2: 127,142,004 N66S possibly damaging Het
Kcnma1 A G 14: 23,373,197 Y686H probably damaging Het
Ndrg1 C A 15: 66,943,159 probably benign Het
Ogdh T C 11: 6,347,216 V545A probably benign Het
Olfr121 A G 17: 37,752,393 I180V possibly damaging Het
P3h3 G A 6: 124,854,306 probably benign Het
Ppme1 A T 7: 100,333,975 probably null Het
Prkag1 T G 15: 98,815,682 D44A probably damaging Het
Prpf39 T C 12: 65,043,371 probably benign Het
Rabep1 C A 11: 70,919,207 R489S probably damaging Het
Scn10a A G 9: 119,694,102 V75A possibly damaging Het
Sema3d T C 5: 12,448,075 L16P possibly damaging Het
Skida1 T C 2: 18,047,186 probably benign Het
Sptbn4 T C 7: 27,364,170 Y2277C probably damaging Het
Syne1 A G 10: 5,348,945 I1047T possibly damaging Het
Syt17 A G 7: 118,381,993 Y369H probably benign Het
Tmem131l C T 3: 83,921,931 probably benign Het
Traf3ip2 A T 10: 39,634,673 D314V probably damaging Het
Ttc28 T G 5: 111,284,067 probably benign Het
Ush1c A C 7: 46,225,448 probably benign Het
Utp20 A T 10: 88,767,107 Y1884N possibly damaging Het
Vmn2r112 T A 17: 22,605,270 I502K probably benign Het
Vmn2r60 T C 7: 42,142,320 probably benign Het
Vmn2r63 T C 7: 42,903,275 I852M probably benign Het
Vmn2r9 T A 5: 108,847,539 E414D probably benign Het
Wnt4 A G 4: 137,295,443 T106A probably damaging Het
Zbtb26 A T 2: 37,436,795 N76K possibly damaging Het
Zfhx2 T C 14: 55,071,988 T885A probably benign Het
Other mutations in Helz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Helz APN 11 107663653 missense possibly damaging 0.90
IGL01419:Helz APN 11 107686514 missense unknown
IGL01864:Helz APN 11 107602354 missense probably damaging 0.98
IGL01999:Helz APN 11 107602928 splice site probably benign
IGL02938:Helz APN 11 107686438 missense unknown
IGL03157:Helz APN 11 107577888 missense possibly damaging 0.95
IGL03374:Helz APN 11 107620147 missense probably damaging 0.98
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0058:Helz UTSW 11 107672558 unclassified probably benign
R0112:Helz UTSW 11 107672948 unclassified probably benign
R0243:Helz UTSW 11 107637914 missense possibly damaging 0.85
R0578:Helz UTSW 11 107686400 missense unknown
R0928:Helz UTSW 11 107626693 missense probably damaging 0.99
R1428:Helz UTSW 11 107592840 splice site probably benign
R1493:Helz UTSW 11 107613925 missense probably benign 0.15
R1494:Helz UTSW 11 107604063 splice site probably benign
R1541:Helz UTSW 11 107670048 missense probably benign 0.39
R1619:Helz UTSW 11 107636279 nonsense probably null
R1809:Helz UTSW 11 107599171 missense possibly damaging 0.87
R1942:Helz UTSW 11 107602492 missense probably benign 0.20
R2095:Helz UTSW 11 107646146 missense probably damaging 1.00
R2133:Helz UTSW 11 107670484 missense unknown
R2167:Helz UTSW 11 107672964 unclassified probably benign
R2406:Helz UTSW 11 107686552 missense unknown
R2571:Helz UTSW 11 107613952 missense probably benign 0.05
R2858:Helz UTSW 11 107672927 unclassified probably benign
R3927:Helz UTSW 11 107685292 missense unknown
R4449:Helz UTSW 11 107604163 missense probably benign 0.01
R4453:Helz UTSW 11 107672629 nonsense probably null
R4583:Helz UTSW 11 107646069 missense probably damaging 1.00
R4684:Helz UTSW 11 107649145 missense probably damaging 1.00
R4714:Helz UTSW 11 107626716 critical splice donor site probably null
R4875:Helz UTSW 11 107637734 intron probably benign
R4924:Helz UTSW 11 107602339 missense probably damaging 1.00
R4930:Helz UTSW 11 107620168 missense probably damaging 0.99
R5078:Helz UTSW 11 107656096 missense probably damaging 1.00
R5446:Helz UTSW 11 107632204 missense probably damaging 1.00
R5535:Helz UTSW 11 107646120 missense probably damaging 0.98
R5650:Helz UTSW 11 107595146 missense probably null 0.96
R5714:Helz UTSW 11 107626521 splice site probably null
R5784:Helz UTSW 11 107670481 missense unknown
R5998:Helz UTSW 11 107685534 nonsense probably null
R6042:Helz UTSW 11 107614120 critical splice donor site probably null
R6089:Helz UTSW 11 107595137 critical splice acceptor site probably null
R6137:Helz UTSW 11 107619060 missense possibly damaging 0.83
R6373:Helz UTSW 11 107595184 missense probably benign 0.01
R6392:Helz UTSW 11 107602341 missense possibly damaging 0.80
R6618:Helz UTSW 11 107599150 missense probably benign 0.01
R6644:Helz UTSW 11 107632261 missense possibly damaging 0.74
R6811:Helz UTSW 11 107619318 critical splice donor site probably null
R6874:Helz UTSW 11 107663634 missense probably damaging 0.97
R6911:Helz UTSW 11 107619225 missense probably benign 0.01
R7039:Helz UTSW 11 107619318 critical splice donor site probably null
R7061:Helz UTSW 11 107649177 missense possibly damaging 0.83
R7438:Helz UTSW 11 107662030 missense probably damaging 0.98
R7464:Helz UTSW 11 107636278 missense probably damaging 1.00
R7513:Helz UTSW 11 107656115 missense probably damaging 0.99
R7559:Helz UTSW 11 107600278 missense possibly damaging 0.67
R7734:Helz UTSW 11 107685422 missense unknown
R7780:Helz UTSW 11 107637863 missense probably damaging 1.00
R7982:Helz UTSW 11 107626630 missense possibly damaging 0.84
R8024:Helz UTSW 11 107686421 missense unknown
R8181:Helz UTSW 11 107672573 missense unknown
R8346:Helz UTSW 11 107672573 missense unknown
R8729:Helz UTSW 11 107637928 critical splice donor site probably null
R8807:Helz UTSW 11 107603009 missense probably damaging 1.00
R8821:Helz UTSW 11 107635093 missense probably damaging 0.99
R8891:Helz UTSW 11 107662016 missense probably damaging 0.99
R8909:Helz UTSW 11 107666008 missense possibly damaging 0.94
R8922:Helz UTSW 11 107649159 missense possibly damaging 0.90
R8926:Helz UTSW 11 107672683 missense unknown
X0065:Helz UTSW 11 107670447 missense unknown
Predicted Primers PCR Primer
(F):5'- CAAGAAGTCCCCGAGAACTGTCAAG -3'
(R):5'- CAAGCACCAAGCAGATCCTGGTAAG -3'

Sequencing Primer
(F):5'- CCCGAGAACTGTCAAGAATGG -3'
(R):5'- GACCTCAAGGTGAGATTTACCTG -3'
Posted On2013-04-16