Incidental Mutation 'R0326:Sos2'
Institutional Source Beutler Lab
Gene Symbol Sos2
Ensembl Gene ENSMUSG00000034801
Gene NameSOS Ras/Rho guanine nucleotide exchange factor 2
MMRRC Submission 038536-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0326 (G1)
Quality Score225
Status Not validated
Chromosomal Location69583762-69681852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69635685 bp
Amino Acid Change Glutamic Acid to Glycine at position 253 (E253G)
Ref Sequence ENSEMBL: ENSMUSP00000138793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035773] [ENSMUST00000182396] [ENSMUST00000183277]
PDB Structure
Predicted Effect probably damaging
Transcript: ENSMUST00000035773
AA Change: E253G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044866
Gene: ENSMUSG00000034801
AA Change: E253G

Pfam:Histone 54 169 3.7e-13 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182396
AA Change: E253G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138589
Gene: ENSMUSG00000034801
AA Change: E253G

Pfam:Histone 97 169 1e-9 PFAM
Pfam:RhoGEF 203 344 1.6e-12 PFAM
PH 410 514 1.54e-14 SMART
RasGEFN 562 707 5.8e-52 SMART
RasGEF 742 986 2.51e-92 SMART
low complexity region 1046 1066 N/A INTRINSIC
low complexity region 1111 1119 N/A INTRINSIC
low complexity region 1140 1159 N/A INTRINSIC
low complexity region 1167 1192 N/A INTRINSIC
low complexity region 1221 1236 N/A INTRINSIC
low complexity region 1243 1259 N/A INTRINSIC
low complexity region 1268 1276 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183277
AA Change: E253G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138793
Gene: ENSMUSG00000034801
AA Change: E253G

Pfam:Histone 97 169 8.9e-11 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.8%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory protein that is involved in the positive regulation of ras proteins. Mutations in this gene are associated with Noonan Syndrome-9. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal embryonic and adult histopathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C T 1: 130,742,898 P286S possibly damaging Het
Aagab T A 9: 63,619,162 S156T probably damaging Het
Abca14 T G 7: 120,224,419 Y390D probably damaging Het
Abcc2 T A 19: 43,825,947 I1122N possibly damaging Het
Adamts16 T C 13: 70,779,611 E503G possibly damaging Het
Adamts9 A T 6: 92,858,057 C697* probably null Het
Adgrv1 T C 13: 81,474,993 D3837G possibly damaging Het
Aire T A 10: 78,042,599 R128S probably damaging Het
Alkbh2 A C 5: 114,123,950 *240E probably null Het
Als2 T C 1: 59,180,583 Y1191C probably damaging Het
Anapc5 A T 5: 122,814,604 V186E probably benign Het
Apob C T 12: 7,990,307 A548V probably damaging Het
B3galt4 A T 17: 33,950,748 V172E probably damaging Het
Bbs7 A C 3: 36,592,376 C432G possibly damaging Het
Cacna2d3 T A 14: 29,045,644 E758V probably damaging Het
Cactin T G 10: 81,322,662 L154R probably benign Het
Ccdc129 A T 6: 55,898,243 M393L possibly damaging Het
Ccdc88a A C 11: 29,461,021 R502S probably benign Het
Ccnf A T 17: 24,231,810 I398N possibly damaging Het
Chd1 A T 17: 15,768,566 D1527V probably damaging Het
Chd1 A T 17: 15,768,568 M1528L probably benign Het
Chrac1 G A 15: 73,092,826 probably null Het
Cln3 T G 7: 126,583,045 M1L probably damaging Het
Cnot6 T C 11: 49,677,436 Y442C probably damaging Het
Col19a1 A T 1: 24,285,051 probably null Het
Col1a2 T C 6: 4,537,838 F1116L unknown Het
Col1a2 G A 6: 4,518,822 probably benign Het
Cops4 T G 5: 100,528,542 V53G probably damaging Het
Crnkl1 A G 2: 145,919,955 S561P probably benign Het
Ctnnb1 C A 9: 120,951,712 Q99K probably benign Het
Cxcr5 T C 9: 44,513,281 S360G probably benign Het
Dab2 G A 15: 6,418,316 V60M probably damaging Het
Ddx3y A T Y: 1,263,321 Y648* probably null Het
Dennd2a T A 6: 39,497,110 D430V probably damaging Het
Dsp G T 13: 38,192,870 E1544* probably null Het
Efcab7 A T 4: 99,831,394 M38L possibly damaging Het
Fto A G 8: 91,409,527 N141S probably damaging Het
Gabrp A G 11: 33,554,362 F318L probably damaging Het
Gm4737 T A 16: 46,153,883 D377V probably benign Het
Gmeb1 A C 4: 132,242,352 C103W probably damaging Het
Heatr9 T C 11: 83,514,539 D365G probably damaging Het
Hif3a G A 7: 17,044,400 R436W probably benign Het
Hint2 A G 4: 43,654,378 V145A probably damaging Het
Hmcn2 T A 2: 31,423,225 L3482* probably null Het
Hsd3b1 A T 3: 98,853,274 Y134N probably damaging Het
Impg2 T A 16: 56,260,485 V775E probably damaging Het
Ipo5 A G 14: 120,922,223 I154M probably benign Het
Itgad T A 7: 128,198,378 F893Y probably benign Het
Kdm4a T C 4: 118,161,706 R438G probably benign Het
Klk11 T A 7: 43,776,519 M1K probably null Het
Lama5 A T 2: 180,182,426 V2602D possibly damaging Het
Lrch3 T C 16: 32,979,500 S35P probably damaging Het
Mfn2 A G 4: 147,883,288 L441P probably damaging Het
Mgat4c A T 10: 102,388,704 I260F probably damaging Het
Mon1b T A 8: 113,637,743 S51T probably benign Het
Myh11 T C 16: 14,218,880 D993G probably benign Het
Myo1a A G 10: 127,716,297 N762D probably benign Het
Nacc2 A T 2: 26,060,333 Y464N probably damaging Het
Nckap1 A G 2: 80,553,370 I150T probably benign Het
Ndufv2 G T 17: 66,080,821 P119T probably damaging Het
Noc4l G A 5: 110,652,375 R95* probably null Het
Ntng1 A T 3: 110,135,503 Y2* probably null Het
Olfr1333 A T 4: 118,829,825 V205D possibly damaging Het
Olfr1423 C T 19: 12,036,161 V194I probably benign Het
Olfr1505 C T 19: 13,919,509 T163I probably benign Het
Olfr804 A G 10: 129,705,769 E297G possibly damaging Het
Oog4 T C 4: 143,439,203 N53D probably benign Het
Phkg2 T G 7: 127,573,903 L11R probably damaging Het
Pogz A G 3: 94,870,113 D368G probably damaging Het
Prex2 T A 1: 11,285,065 L1530Q probably damaging Het
Prmt1 C T 7: 44,979,454 E144K probably damaging Het
Prss8 T A 7: 127,927,176 I121F probably benign Het
Psmd13 T C 7: 140,897,711 L314P probably damaging Het
Ptch2 G A 4: 117,108,884 G467D probably damaging Het
Rbm20 C A 19: 53,864,165 P1192Q probably damaging Het
Rpl19 T A 11: 98,028,374 D45E probably benign Het
Rsph10b C T 5: 143,967,128 A219V probably damaging Het
Rtraf C T 14: 19,814,532 probably null Het
Scaf1 T A 7: 45,008,751 T235S probably damaging Het
Shank1 T A 7: 44,319,170 C296S unknown Het
Slc39a7 A T 17: 34,028,950 V426D probably damaging Het
Slc41a2 A T 10: 83,283,746 V384D probably damaging Het
Slco1c1 T C 6: 141,559,773 L475P probably benign Het
Slco6d1 A C 1: 98,490,634 K515T probably benign Het
Sp6 G T 11: 97,021,535 D25Y possibly damaging Het
Syt11 A C 3: 88,762,548 D12E possibly damaging Het
Taf2 A G 15: 55,047,460 L606P probably damaging Het
Tbc1d5 A G 17: 50,966,736 Y116H probably damaging Het
Tnfrsf8 A G 4: 145,288,459 I243T possibly damaging Het
Tnxb A G 17: 34,698,179 S2183G probably benign Het
Trim66 T C 7: 109,460,172 Y853C probably benign Het
Ttn T A 2: 76,737,495 T27685S probably damaging Het
Ttn T C 2: 76,743,122 E25809G probably damaging Het
Uvssa G A 5: 33,408,847 G445S probably benign Het
Zfp326 T C 5: 105,910,275 S427P probably damaging Het
Zfp592 A G 7: 81,024,889 T534A possibly damaging Het
Zfp672 A G 11: 58,316,347 S383P possibly damaging Het
Zfp799 A G 17: 32,820,726 S188P possibly damaging Het
Zyg11b A C 4: 108,272,253 V54G possibly damaging Het
Other mutations in Sos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Sos2 APN 12 69616849 splice site probably benign
IGL01348:Sos2 APN 12 69618092 missense probably damaging 0.99
IGL01360:Sos2 APN 12 69590800 missense probably benign 0.00
IGL01586:Sos2 APN 12 69607398 missense probably damaging 1.00
IGL01721:Sos2 APN 12 69603867 missense probably damaging 0.99
IGL02024:Sos2 APN 12 69618048 splice site probably benign
IGL02347:Sos2 APN 12 69596746 missense probably benign
IGL02419:Sos2 APN 12 69616990 missense probably benign
IGL02684:Sos2 APN 12 69596666 missense probably damaging 1.00
IGL02719:Sos2 APN 12 69617184 missense probably benign 0.00
IGL03099:Sos2 APN 12 69616359 missense probably damaging 1.00
Bechamel UTSW 12 69603553 missense probably damaging 1.00
sauce UTSW 12 69596795 missense probably damaging 1.00
PIT4131001:Sos2 UTSW 12 69618077 missense probably benign
R0038:Sos2 UTSW 12 69596693 missense probably damaging 1.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R1386:Sos2 UTSW 12 69614658 missense probably damaging 1.00
R1472:Sos2 UTSW 12 69585316 splice site probably null
R1534:Sos2 UTSW 12 69616955 missense probably damaging 1.00
R1861:Sos2 UTSW 12 69617363 missense probably damaging 1.00
R1934:Sos2 UTSW 12 69648541 missense probably damaging 0.99
R1964:Sos2 UTSW 12 69616862 missense possibly damaging 0.51
R2402:Sos2 UTSW 12 69596799 missense possibly damaging 0.95
R2516:Sos2 UTSW 12 69650659 missense probably damaging 0.99
R2571:Sos2 UTSW 12 69635718 missense possibly damaging 0.95
R3423:Sos2 UTSW 12 69603553 missense probably damaging 1.00
R4435:Sos2 UTSW 12 69614699 missense possibly damaging 0.79
R4508:Sos2 UTSW 12 69635661 nonsense probably null
R4595:Sos2 UTSW 12 69616889 missense probably damaging 1.00
R4606:Sos2 UTSW 12 69614606 intron probably benign
R4691:Sos2 UTSW 12 69616328 missense probably damaging 1.00
R4716:Sos2 UTSW 12 69607371 missense probably benign 0.04
R4863:Sos2 UTSW 12 69640154 missense probably benign 0.04
R5179:Sos2 UTSW 12 69650728 nonsense probably null
R5319:Sos2 UTSW 12 69627284 missense probably benign 0.22
R5694:Sos2 UTSW 12 69590915 missense probably damaging 0.96
R5877:Sos2 UTSW 12 69596795 missense probably damaging 1.00
R6363:Sos2 UTSW 12 69632111 missense probably benign 0.00
R6465:Sos2 UTSW 12 69596775 missense probably benign 0.01
R6817:Sos2 UTSW 12 69618161 missense probably benign 0.32
R6822:Sos2 UTSW 12 69650649 missense probably damaging 1.00
R7015:Sos2 UTSW 12 69585235 missense probably benign 0.43
R7562:Sos2 UTSW 12 69635638 missense probably benign 0.12
R7570:Sos2 UTSW 12 69590880 missense probably damaging 1.00
R7757:Sos2 UTSW 12 69648585 missense probably damaging 0.99
R7975:Sos2 UTSW 12 69593040 missense probably benign 0.20
R8079:Sos2 UTSW 12 69607215 missense probably damaging 1.00
R8194:Sos2 UTSW 12 69598824 missense probably damaging 1.00
Z1177:Sos2 UTSW 12 69585592 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- cctgactctgttgctctatcc -3'
Posted On2013-04-16