Incidental Mutation 'R3721:Pde10a'
ID258932
Institutional Source Beutler Lab
Gene Symbol Pde10a
Ensembl Gene ENSMUSG00000023868
Gene Namephosphodiesterase 10A
Synonyms
MMRRC Submission 040712-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3721 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location8525372-8986648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8969589 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 907 (I907N)
Ref Sequence ENSEMBL: ENSMUSP00000156356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115708] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]
Predicted Effect probably damaging
Transcript: ENSMUST00000024647
AA Change: I545N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868
AA Change: I545N

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000089085
AA Change: I625N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868
AA Change: I625N

DomainStartEndE-ValueType
GAF 101 254 1.44e-3 SMART
GAF 276 432 6.56e-29 SMART
HDc 522 688 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115708
AA Change: I341N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111373
Gene: ENSMUSG00000023868
AA Change: I341N

DomainStartEndE-ValueType
GAF 3 148 5.22e-23 SMART
HDc 238 404 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115715
AA Change: I545N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868
AA Change: I545N

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115717
Predicted Effect possibly damaging
Transcript: ENSMUST00000115720
AA Change: I608N

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868
AA Change: I608N

DomainStartEndE-ValueType
GAF 84 237 1.44e-3 SMART
GAF 259 415 6.56e-29 SMART
HDc 505 671 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115724
AA Change: I679N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: I679N

DomainStartEndE-ValueType
GAF 95 248 1.44e-3 SMART
GAF 270 426 6.56e-29 SMART
HDc 516 682 9.04e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000149440
AA Change: I556N

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868
AA Change: I556N

DomainStartEndE-ValueType
GAF 32 185 1.44e-3 SMART
GAF 207 363 6.56e-29 SMART
HDc 453 619 9.04e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231430
AA Change: I907N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4048 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvr2a T C 2: 48,892,138 S228P probably damaging Het
Adamts2 C T 11: 50,773,211 probably benign Het
Arhgap9 A G 10: 127,328,971 E588G possibly damaging Het
Ash2l C G 8: 25,818,625 G453A probably damaging Het
Catsperg2 A G 7: 29,705,102 V638A probably benign Het
Ccrl2 T C 9: 111,056,364 D22G probably benign Het
Cdc73 T C 1: 143,695,453 I83V possibly damaging Het
Clec2e C A 6: 129,094,410 E155* probably null Het
Cyp3a59 T A 5: 146,096,597 M181K probably damaging Het
Dars2 A T 1: 161,063,308 V111E probably benign Het
Diras2 T A 13: 52,508,023 I83F probably damaging Het
Dlg2 T A 7: 91,711,800 probably null Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Emilin2 T C 17: 71,273,454 N759S probably benign Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fam102b C T 3: 108,979,767 R305Q probably damaging Het
Ggnbp1 T C 17: 27,029,613 V52A probably benign Het
Gm5155 A G 7: 17,902,738 T247A probably benign Het
Gpr171 A G 3: 59,097,670 V228A possibly damaging Het
Gsta3 T C 1: 21,260,089 M55T probably benign Het
Hectd3 T A 4: 116,999,745 N496K probably benign Het
Hp1bp3 T G 4: 138,239,608 F367V probably damaging Het
Il18rap T A 1: 40,537,088 L253Q probably damaging Het
Irs1 C T 1: 82,290,085 G137S probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lair1 A C 7: 4,010,783 L155R probably damaging Het
Larp7 A G 3: 127,546,811 L126P probably damaging Het
Lhx1 G A 11: 84,521,828 R89C probably damaging Het
Lypd4 C A 7: 24,865,459 A85S probably benign Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Myh10 G T 11: 68,813,052 R1863L probably damaging Het
Myo9a G A 9: 59,868,180 V1025I probably benign Het
Naa25 T A 5: 121,431,556 D659E probably benign Het
Nol9 A G 4: 152,039,706 S118G probably benign Het
Olfr497 G T 7: 108,423,119 D183Y probably damaging Het
Olfr730 C T 14: 50,186,680 C179Y probably damaging Het
Pkhd1 T C 1: 20,585,655 D218G probably benign Het
Poll A G 19: 45,553,577 I430T probably damaging Het
Pomgnt1 T G 4: 116,153,543 probably benign Het
Rab6b T C 9: 103,167,174 probably null Het
Rad1 T C 15: 10,488,026 S79P probably benign Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Rcc1 T C 4: 132,337,814 K133E possibly damaging Het
Ric8a T C 7: 140,861,961 probably null Het
Rnf135 G T 11: 80,196,917 A231S probably benign Het
Rps6ka4 A G 19: 6,839,277 V146A possibly damaging Het
Sh3bp4 A G 1: 89,145,328 I633V possibly damaging Het
Slc2a2 T A 3: 28,727,152 N446K probably damaging Het
Slc44a1 T C 4: 53,491,445 Y61H probably damaging Het
Slc7a1 G A 5: 148,335,533 R445* probably null Het
Smc5 T C 19: 23,210,492 M911V probably benign Het
Sntb1 C A 15: 55,642,818 R453L probably benign Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Srrm2 CTCCTCTTCTTCCTCTTCTTCCTC CTCCTCTTCTTCCTC 17: 23,822,575 probably benign Het
Trpm1 T G 7: 64,217,727 probably benign Het
Tufm T C 7: 126,490,460 M442T probably benign Het
Ubn1 A G 16: 5,073,378 N539S possibly damaging Het
Other mutations in Pde10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Pde10a APN 17 8944970 missense probably damaging 1.00
IGL01762:Pde10a APN 17 8942918 missense possibly damaging 0.74
IGL01814:Pde10a APN 17 8929107 start codon destroyed probably null 0.00
IGL02053:Pde10a APN 17 8974769 missense probably damaging 1.00
IGL02386:Pde10a APN 17 8953804 missense possibly damaging 0.93
IGL02573:Pde10a APN 17 8961890 missense probably benign 0.38
IGL02583:Pde10a APN 17 8981630 missense probably benign 0.23
IGL02649:Pde10a APN 17 8953772 missense probably damaging 1.00
IGL02992:Pde10a APN 17 8949461 missense probably damaging 0.97
IGL03109:Pde10a APN 17 8929214 critical splice donor site probably null
Bride UTSW 17 8949430 missense possibly damaging 0.60
buzzed UTSW 17 8930537 missense probably damaging 1.00
Gracile UTSW 17 8961920 missense possibly damaging 0.63
nubile UTSW 17 8967462 missense probably damaging 1.00
thunderball UTSW 17 8969589 missense probably damaging 1.00
R0004:Pde10a UTSW 17 8981576 missense probably benign 0.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0015:Pde10a UTSW 17 8977197 missense probably damaging 1.00
R0650:Pde10a UTSW 17 8942965 missense probably damaging 1.00
R1173:Pde10a UTSW 17 8920546 splice site probably benign
R1386:Pde10a UTSW 17 8953742 missense probably damaging 1.00
R1458:Pde10a UTSW 17 8964708 missense probably damaging 0.98
R1598:Pde10a UTSW 17 8929144 missense probably damaging 1.00
R1661:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1665:Pde10a UTSW 17 8898870 missense probably damaging 1.00
R1883:Pde10a UTSW 17 8978944 missense possibly damaging 0.86
R1960:Pde10a UTSW 17 8942918 missense possibly damaging 0.74
R2005:Pde10a UTSW 17 8929091 critical splice acceptor site probably null
R2071:Pde10a UTSW 17 8961995 missense probably benign 0.22
R2121:Pde10a UTSW 17 8977215 missense probably damaging 1.00
R2376:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R3872:Pde10a UTSW 17 8757091 missense possibly damaging 0.92
R4627:Pde10a UTSW 17 8981652 missense probably damaging 1.00
R4652:Pde10a UTSW 17 8757053 missense possibly damaging 0.82
R5107:Pde10a UTSW 17 8944970 missense probably damaging 1.00
R5184:Pde10a UTSW 17 8977155 missense probably damaging 1.00
R5354:Pde10a UTSW 17 8961980 missense probably damaging 0.97
R5735:Pde10a UTSW 17 8941192 missense probably damaging 0.99
R5878:Pde10a UTSW 17 8949372 missense possibly damaging 0.85
R5921:Pde10a UTSW 17 8930537 missense probably damaging 1.00
R6027:Pde10a UTSW 17 8964677 missense possibly damaging 0.78
R6145:Pde10a UTSW 17 8929117 missense probably damaging 1.00
R6279:Pde10a UTSW 17 8978957 missense probably damaging 0.99
R6409:Pde10a UTSW 17 8949438 missense probably damaging 1.00
R6870:Pde10a UTSW 17 8967524 missense possibly damaging 0.56
R6947:Pde10a UTSW 17 8969592 missense probably damaging 1.00
R7072:Pde10a UTSW 17 8943026 missense probably benign 0.40
R7084:Pde10a UTSW 17 8941162 missense probably benign 0.25
R7294:Pde10a UTSW 17 8757021 missense probably benign
R7339:Pde10a UTSW 17 8757028 missense probably benign 0.01
R7347:Pde10a UTSW 17 8967462 missense probably damaging 1.00
R7373:Pde10a UTSW 17 8942992 missense probably benign 0.00
R7481:Pde10a UTSW 17 8949430 missense possibly damaging 0.60
R7833:Pde10a UTSW 17 8961920 missense possibly damaging 0.63
R7923:Pde10a UTSW 17 8929132 missense probably benign 0.40
R8053:Pde10a UTSW 17 8974772 missense probably benign 0.12
R8137:Pde10a UTSW 17 8974815 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CATTGCAATGAAGCAGACCC -3'
(R):5'- CCTCTACTGAGCATGTGCAC -3'

Sequencing Primer
(F):5'- TTGCAATGAAGCAGACCCCATTTC -3'
(R):5'- TGTGCACACCCCGAGTTACAG -3'
Posted On2015-01-23