Mutagenetix > Incidental Mutation

Incidental Mutation 'R3722:Ncstn'

258941

Institutional Source

Beutler Lab

Gene Symbol

Ncstn

Ensembl Gene

ENSMUSG00000003458

Gene Name

nicastrin

Synonyms

D1Dau13e, 9430068N19Rik, Nct, nicastrin

MMRRC Submission

040713-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3722 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

171893580-171910356 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 171895462 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 562 (T562M)

Ref Sequence

ENSEMBL: ENSMUSP00000003550 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003550] [ENSMUST00000140643] [ENSMUST00000146137]

AlphaFold

P57716

Predicted Effect

possibly damaging
Transcript: ENSMUST00000003550
AA Change: T562M

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000003550
Gene: ENSMUSG00000003458
AA Change: T562M

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Peptidase_M28	254	468	2.9e-7	PFAM
Pfam:Nicastrin	273	498	1.6e-94	PFAM
transmembrane domain	669	691	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122986

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135928

Predicted Effect

probably benign
Transcript: ENSMUST00000140643

SMART Domains

Protein: ENSMUSP00000119128
Gene: ENSMUSG00000003458

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146137

SMART Domains

Protein: ENSMUSP00000120663
Gene: ENSMUSG00000003458

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.9%

Validation Efficiency

98% (61/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane glycoprotein that is an integral component of the multimeric gamma-secretase complex. The encoded protein cleaves integral membrane proteins, including Notch receptors and beta-amyloid precursor protein, and may be a stabilizing cofactor required for gamma-secretase complex assembly. The cleavage of beta-amyloid precursor protein yields amyloid beta peptide, the main component of the neuritic plaque and the hallmark lesion in the brains of patients with Alzheimer's disease; however, the nature of the encoded protein's role in Alzheimer's disease is not known for certain. Mutations in this gene are associated with familial acne inversa. A pseudogene of this gene is present on chromosome 21. Alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant embryos die exhibiting morphological defects of the somites, yolk sac vasculature, neural tube, and pericardial sacs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	A	T	10: 10,216,254 (GRCm39)	S1485T	probably benign	Het
Akap9	A	G	5: 4,120,351 (GRCm39)	Y3589C	probably damaging	Het
Alkbh8	T	C	9: 3,385,153 (GRCm39)	Y482H	probably damaging	Het
Appl1	G	A	14: 26,649,801 (GRCm39)	T575M	probably damaging	Het
Arhgap21	T	C	2: 20,855,102 (GRCm39)	E1420G	probably damaging	Het
Asic3	A	T	5: 24,621,997 (GRCm39)	Y419F	probably benign	Het
Atg7	A	G	6: 114,672,624 (GRCm39)	Y279C	probably damaging	Het
Braf	G	A	6: 39,600,610 (GRCm39)	P616L	probably damaging	Het
Btnl2	T	C	17: 34,577,109 (GRCm39)	M88T	possibly damaging	Het
C1rb	T	A	6: 124,557,620 (GRCm39)	Y586N	probably damaging	Het
Cacna1s	T	C	1: 135,996,780 (GRCm39)	F127S	possibly damaging	Het
Cd47	A	G	16: 49,688,205 (GRCm39)	I42V	probably benign	Het
Cox8b	T	A	7: 140,478,918 (GRCm39)	K66*	probably null	Het
Diras2	T	A	13: 52,662,059 (GRCm39)	I83F	probably damaging	Het
Dlg2	T	A	7: 91,361,008 (GRCm39)		probably null	Het
Dnah8	G	A	17: 31,073,872 (GRCm39)	R4514H	probably damaging	Het
Dnai1	G	A	4: 41,602,615 (GRCm39)	R113H	probably damaging	Het
Dolpp1	T	C	2: 30,287,500 (GRCm39)	L204P	probably damaging	Het
Fam170a	C	T	18: 50,415,271 (GRCm39)	P306S	probably benign	Het
Fbxl12	A	T	9: 20,550,268 (GRCm39)		probably null	Het
Fndc3a	T	A	14: 72,777,648 (GRCm39)	I1186F	probably benign	Het
Gm12886	T	A	4: 121,274,667 (GRCm39)	D71V	probably damaging	Het
H3c8	T	C	13: 23,719,722 (GRCm39)	V36A	possibly damaging	Het
Ica1	A	G	6: 8,659,021 (GRCm39)		probably benign	Het
Ighv8-11	A	G	12: 115,530,771 (GRCm39)	I119T	possibly damaging	Het
Ism1	A	T	2: 139,573,931 (GRCm39)	R94*	probably null	Het
Kbtbd11	T	A	8: 15,079,118 (GRCm39)	C572*	probably null	Het
Kcnk15	T	C	2: 163,700,214 (GRCm39)	L132P	probably damaging	Het
Lrmda	T	A	14: 22,077,399 (GRCm39)		probably benign	Het
Mei1	A	G	15: 81,987,405 (GRCm39)	H399R	possibly damaging	Het
Mrtfb	C	T	16: 13,203,557 (GRCm39)	A201V	probably damaging	Het
Nudt4	A	T	10: 95,385,367 (GRCm39)		probably null	Het
Omp	T	C	7: 97,794,420 (GRCm39)	N69S	probably benign	Het
Or10d3	A	C	9: 39,461,418 (GRCm39)	C250G	probably damaging	Het
Or4a75	A	T	2: 89,448,503 (GRCm39)	I11N	possibly damaging	Het
Pak1	C	T	7: 97,503,704 (GRCm39)	P13L	probably damaging	Het
Pde4d	T	A	13: 110,087,866 (GRCm39)	C744*	probably null	Het
Pelp1	T	C	11: 70,289,026 (GRCm39)	Y240C	possibly damaging	Het
Pou2f1	G	C	1: 165,722,538 (GRCm39)	P349R	probably damaging	Het
Ptprk	A	G	10: 28,259,619 (GRCm39)	D353G	probably damaging	Het
Ptprs	A	G	17: 56,724,485 (GRCm39)	F1152S	probably damaging	Het
Rnf135	G	T	11: 80,087,743 (GRCm39)	A231S	probably benign	Het
Rpn1	G	A	6: 88,067,282 (GRCm39)		probably null	Het
Rreb1	T	A	13: 38,131,074 (GRCm39)	D1409E	probably benign	Het
Sipa1l2	G	A	8: 126,200,323 (GRCm39)	H668Y	probably damaging	Het
Slc35a5	A	T	16: 44,967,685 (GRCm39)	I138N	probably damaging	Het
Slc35d1	T	C	4: 103,065,321 (GRCm39)	K187E	possibly damaging	Het
Slc44a2	A	T	9: 21,254,273 (GRCm39)	I212F	possibly damaging	Het
Slc7a1	G	A	5: 148,272,343 (GRCm39)	R445*	probably null	Het
Snapc4	A	G	2: 26,255,440 (GRCm39)	L1028P	probably benign	Het
Snrnp40	C	T	4: 130,262,068 (GRCm39)	T152I	possibly damaging	Het
Spata31f1a	T	C	4: 42,851,472 (GRCm39)	E228G	probably benign	Het
Spink4	T	A	4: 40,929,136 (GRCm39)	C54S	probably damaging	Het
Tex2	C	T	11: 106,437,566 (GRCm39)	W203*	probably null	Het
Tmcc1	T	C	6: 116,110,783 (GRCm39)	E170G	possibly damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,648 (GRCm39)		probably benign	Het
Ttc23l	G	A	15: 10,537,652 (GRCm39)	S206L	probably benign	Het
Ttll6	A	G	11: 96,024,747 (GRCm39)	N46D	probably benign	Het
Txk	T	A	5: 72,865,078 (GRCm39)	K266*	probably null	Het
Uggt2	T	C	14: 119,278,930 (GRCm39)	E859G	probably damaging	Het
Uros	A	T	7: 133,304,120 (GRCm39)	M1K	probably null	Het
Vps13b	T	A	15: 35,671,528 (GRCm39)	I1677N	probably damaging	Het
Zbtb5	A	G	4: 44,994,863 (GRCm39)		probably null	Het
Zfp760	A	G	17: 21,941,143 (GRCm39)	Y106C	probably damaging	Het

Other mutations in Ncstn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00737:Ncstn	APN	1	171,901,968 (GRCm39)	missense	probably benign	0.02
IGL02030:Ncstn	APN	1	171,900,024 (GRCm39)	splice site	probably benign
IGL02470:Ncstn	APN	1	171,910,166 (GRCm39)	critical splice donor site	probably null
IGL02498:Ncstn	APN	1	171,896,159 (GRCm39)	missense	probably benign
morel	UTSW	1	171,900,043 (GRCm39)	missense	probably damaging	0.99
Pig	UTSW	1	171,899,092 (GRCm39)	missense	probably damaging	1.00
truffle	UTSW	1	171,897,576 (GRCm39)	missense	probably damaging	1.00
R0048:Ncstn	UTSW	1	171,897,528 (GRCm39)	splice site	probably benign
R0480:Ncstn	UTSW	1	171,910,159 (GRCm39)	splice site	probably benign
R0648:Ncstn	UTSW	1	171,895,454 (GRCm39)	missense	probably benign	0.01
R0792:Ncstn	UTSW	1	171,899,072 (GRCm39)	missense	possibly damaging	0.95
R1330:Ncstn	UTSW	1	171,899,092 (GRCm39)	missense	probably damaging	1.00
R1524:Ncstn	UTSW	1	171,899,716 (GRCm39)	missense	possibly damaging	0.58
R1660:Ncstn	UTSW	1	171,894,339 (GRCm39)	missense	possibly damaging	0.78
R1828:Ncstn	UTSW	1	171,899,038 (GRCm39)	frame shift	probably null
R1892:Ncstn	UTSW	1	171,899,038 (GRCm39)	frame shift	probably null
R1907:Ncstn	UTSW	1	171,899,710 (GRCm39)	missense	probably damaging	0.97
R3876:Ncstn	UTSW	1	171,897,640 (GRCm39)	missense	probably benign	0.02
R3946:Ncstn	UTSW	1	171,895,061 (GRCm39)	missense	probably benign	0.00
R3969:Ncstn	UTSW	1	171,897,576 (GRCm39)	missense	probably damaging	1.00
R4108:Ncstn	UTSW	1	171,900,111 (GRCm39)	missense	probably damaging	1.00
R4597:Ncstn	UTSW	1	171,895,823 (GRCm39)	nonsense	probably null
R4998:Ncstn	UTSW	1	171,899,087 (GRCm39)	missense	possibly damaging	0.81
R5037:Ncstn	UTSW	1	171,896,193 (GRCm39)	missense	probably damaging	1.00
R5150:Ncstn	UTSW	1	171,895,151 (GRCm39)	intron	probably benign
R5406:Ncstn	UTSW	1	171,899,731 (GRCm39)	missense	probably benign	0.00
R5444:Ncstn	UTSW	1	171,900,406 (GRCm39)	missense	possibly damaging	0.92
R5605:Ncstn	UTSW	1	171,908,717 (GRCm39)	intron	probably benign
R6675:Ncstn	UTSW	1	171,899,095 (GRCm39)	missense	probably damaging	1.00
R7268:Ncstn	UTSW	1	171,908,830 (GRCm39)	missense	possibly damaging	0.86
R7290:Ncstn	UTSW	1	171,900,373 (GRCm39)	missense	probably benign
R7871:Ncstn	UTSW	1	171,903,023 (GRCm39)	missense	probably benign	0.00
R8238:Ncstn	UTSW	1	171,900,043 (GRCm39)	missense	probably damaging	0.99
R9462:Ncstn	UTSW	1	171,899,707 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAGAGTCCCAACTTCTCCGAG -3'
(R):5'- TGCTGTGAGAAGGGTGATCC -3'

Sequencing Primer
(F):5'- GTCCCAACTTCTCCGAGGGAAAG -3'
(R):5'- GTGATCCCCACCTGATAAACTATG -3'

Posted On

2015-01-23