Incidental Mutation 'R3722:Slc7a1'
ID258959
Institutional Source Beutler Lab
Gene Symbol Slc7a1
Ensembl Gene ENSMUSG00000041313
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 1
SynonymsRev-1, Rec-1, Atrc1, Cat1, mCAT-1, 4831426K01Rik, Atrc-1
MMRRC Submission 040713-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3722 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location148327410-148399904 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 148335533 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 445 (R445*)
Ref Sequence ENSEMBL: ENSMUSP00000117781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048116] [ENSMUST00000138257]
Predicted Effect probably null
Transcript: ENSMUST00000048116
AA Change: R445*
SMART Domains Protein: ENSMUSP00000046714
Gene: ENSMUSG00000041313
AA Change: R445*

DomainStartEndE-ValueType
Pfam:AA_permease_2 32 440 1.3e-51 PFAM
Pfam:AA_permease 36 431 1.3e-42 PFAM
transmembrane domain 487 509 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Pfam:AA_permease_C 551 601 1.2e-28 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000138257
AA Change: R445*
SMART Domains Protein: ENSMUSP00000117781
Gene: ENSMUSG00000041313
AA Change: R445*

DomainStartEndE-ValueType
Pfam:AA_permease_2 32 439 6e-52 PFAM
Pfam:AA_permease 36 433 2.3e-43 PFAM
transmembrane domain 487 509 N/A INTRINSIC
transmembrane domain 519 541 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: Homozygous mutants die on the first day of birth and are very anemic. Peripheral blood contains 50% fewer red blood cells, reduced hemoglobin levels, and a defect in erythroid maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,340,510 S1485T probably benign Het
Akap9 A G 5: 4,070,351 Y3589C probably damaging Het
Alkbh8 T C 9: 3,385,153 Y482H probably damaging Het
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Arhgap21 T C 2: 20,850,291 E1420G probably damaging Het
Asic3 A T 5: 24,416,999 Y419F probably benign Het
Atg7 A G 6: 114,695,663 Y279C probably damaging Het
Braf G A 6: 39,623,676 P616L probably damaging Het
Btnl2 T C 17: 34,358,135 M88T possibly damaging Het
C1rb T A 6: 124,580,661 Y586N probably damaging Het
Cacna1s T C 1: 136,069,042 F127S possibly damaging Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cox8b T A 7: 140,899,005 K66* probably null Het
Diras2 T A 13: 52,508,023 I83F probably damaging Het
Dlg2 T A 7: 91,711,800 probably null Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Dolpp1 T C 2: 30,397,488 L204P probably damaging Het
Fam170a C T 18: 50,282,204 P306S probably benign Het
Fam205a1 T C 4: 42,851,472 E228G probably benign Het
Fbxl12 A T 9: 20,638,972 probably null Het
Fndc3a T A 14: 72,540,208 I1186F probably benign Het
Gm12886 T A 4: 121,417,470 D71V probably damaging Het
Hist1h3g T C 13: 23,535,552 V36A possibly damaging Het
Ica1 A G 6: 8,659,021 probably benign Het
Ighv8-11 A G 12: 115,567,151 I119T possibly damaging Het
Ism1 A T 2: 139,732,011 R94* probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kcnk15 T C 2: 163,858,294 L132P probably damaging Het
Lrmda T A 14: 22,027,331 probably benign Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mkl2 C T 16: 13,385,693 A201V probably damaging Het
Ncstn G A 1: 172,067,895 T562M possibly damaging Het
Nudt4 A T 10: 95,549,505 probably null Het
Olfr1248 A T 2: 89,618,159 I11N possibly damaging Het
Olfr958 A C 9: 39,550,122 C250G probably damaging Het
Omp T C 7: 98,145,213 N69S probably benign Het
Pak1 C T 7: 97,854,497 P13L probably damaging Het
Pde4d T A 13: 109,951,332 C744* probably null Het
Pelp1 T C 11: 70,398,200 Y240C possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Ptprk A G 10: 28,383,623 D353G probably damaging Het
Ptprs A G 17: 56,417,485 F1152S probably damaging Het
Rnf135 G T 11: 80,196,917 A231S probably benign Het
Rpn1 G A 6: 88,090,300 probably null Het
Rreb1 T A 13: 37,947,098 D1409E probably benign Het
Sipa1l2 G A 8: 125,473,584 H668Y probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Slc35d1 T C 4: 103,208,124 K187E possibly damaging Het
Slc44a2 A T 9: 21,342,977 I212F possibly damaging Het
Snapc4 A G 2: 26,365,428 L1028P probably benign Het
Snrnp40 C T 4: 130,368,275 T152I possibly damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Tex2 C T 11: 106,546,740 W203* probably null Het
Tmcc1 T C 6: 116,133,822 E170G possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Ttll6 A G 11: 96,133,921 N46D probably benign Het
Txk T A 5: 72,707,735 K266* probably null Het
Uggt2 T C 14: 119,041,518 E859G probably damaging Het
Uros A T 7: 133,702,391 M1K probably null Het
Vps13b T A 15: 35,671,382 I1677N probably damaging Het
Zbtb5 A G 4: 44,994,863 probably null Het
Zfp760 A G 17: 21,722,162 Y106C probably damaging Het
Other mutations in Slc7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Slc7a1 APN 5 148337192 missense possibly damaging 0.61
H8441:Slc7a1 UTSW 5 148334545 missense probably benign 0.17
R0016:Slc7a1 UTSW 5 148334583 missense probably benign 0.04
R0028:Slc7a1 UTSW 5 148335511 missense probably benign 0.00
R0103:Slc7a1 UTSW 5 148352426 nonsense probably null
R0103:Slc7a1 UTSW 5 148352426 nonsense probably null
R0565:Slc7a1 UTSW 5 148352069 missense probably damaging 1.00
R0696:Slc7a1 UTSW 5 148340556 missense probably benign 0.11
R1338:Slc7a1 UTSW 5 148345936 missense probably damaging 1.00
R1539:Slc7a1 UTSW 5 148335593 missense possibly damaging 0.95
R1926:Slc7a1 UTSW 5 148348303 missense probably damaging 1.00
R2895:Slc7a1 UTSW 5 148340592 missense probably benign 0.06
R2910:Slc7a1 UTSW 5 148352257 missense probably benign 0.00
R3721:Slc7a1 UTSW 5 148335533 nonsense probably null
R4028:Slc7a1 UTSW 5 148345812 missense probably benign 0.01
R4114:Slc7a1 UTSW 5 148342057 missense probably damaging 1.00
R4510:Slc7a1 UTSW 5 148340562 missense probably damaging 1.00
R4511:Slc7a1 UTSW 5 148340562 missense probably damaging 1.00
R4600:Slc7a1 UTSW 5 148342059 missense probably damaging 1.00
R4657:Slc7a1 UTSW 5 148352399 missense probably benign
R4723:Slc7a1 UTSW 5 148335440 missense probably damaging 0.99
R5248:Slc7a1 UTSW 5 148333988 missense possibly damaging 0.91
R5697:Slc7a1 UTSW 5 148333982 missense probably benign 0.00
R6027:Slc7a1 UTSW 5 148333964 missense possibly damaging 0.94
R6370:Slc7a1 UTSW 5 148340673 missense probably damaging 1.00
R6847:Slc7a1 UTSW 5 148334658 missense probably benign
R7007:Slc7a1 UTSW 5 148352446
R7635:Slc7a1 UTSW 5 148352236 missense probably damaging 0.99
V1024:Slc7a1 UTSW 5 148334545 missense probably benign 0.17
Z1177:Slc7a1 UTSW 5 148352165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCTCATGCCTGTGGAGC -3'
(R):5'- TGTGTCCCAGGCACCTTAAC -3'

Sequencing Primer
(F):5'- TTCCCAGGAAAACGGGAGCTC -3'
(R):5'- CCTTTGAATGCACAGTGAGAACTCAG -3'
Posted On2015-01-23