Incidental Mutation 'R3722:Uros'
ID258967
Institutional Source Beutler Lab
Gene Symbol Uros
Ensembl Gene ENSMUSG00000030979
Gene Nameuroporphyrinogen III synthase
Synonymshydroxymethylbilane hydrolyase (cyclizing), URO-synthase, uroporphyrinogen-III synthase, Uros3
MMRRC Submission 040713-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3722 (G1)
Quality Score202
Status Validated
Chromosome7
Chromosomal Location133686243-133710072 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 133702391 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000147433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033276] [ENSMUST00000106144] [ENSMUST00000106145] [ENSMUST00000106146] [ENSMUST00000124759] [ENSMUST00000151348] [ENSMUST00000153698] [ENSMUST00000209636]
Predicted Effect probably null
Transcript: ENSMUST00000033276
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000033276
Gene: ENSMUSG00000030979
AA Change: M1K

DomainStartEndE-ValueType
Pfam:HEM4 17 253 1.2e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106144
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101750
Gene: ENSMUSG00000030979
AA Change: M1K

DomainStartEndE-ValueType
Pfam:HEM4 17 168 5.1e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106145
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101751
Gene: ENSMUSG00000030979
AA Change: M1K

DomainStartEndE-ValueType
Pfam:HEM4 17 253 2.9e-45 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106146
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101752
Gene: ENSMUSG00000030979
AA Change: M1K

DomainStartEndE-ValueType
Pfam:HEM4 17 253 1.2e-44 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000124759
AA Change: M1K

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135760
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144789
Predicted Effect probably null
Transcript: ENSMUST00000151348
AA Change: M1K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect probably null
Transcript: ENSMUST00000153698
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably null
Transcript: ENSMUST00000209636
AA Change: M1K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.9558 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: The protein encoded by this gene is the fourth enzyme in the heme biosynthesis pathway. It converts hydroxymethylbilane to uroporphyrinogen III, a cyclic tetrapyrrole. This enzyme is defective in the autosomal recessive disorder congenital erythropoietic porphyria. Alternate promoter usage controls cell type-specific expression, including erythroid cell-specific expression. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality before implantation. Knock-in mice with sufficient residual enzymatic activity for survival display hemolytic anemia, hepatosplenomegaly, increased porphyrin level, erythruria, porphyria, and skin photosensitivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,340,510 S1485T probably benign Het
Akap9 A G 5: 4,070,351 Y3589C probably damaging Het
Alkbh8 T C 9: 3,385,153 Y482H probably damaging Het
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Arhgap21 T C 2: 20,850,291 E1420G probably damaging Het
Asic3 A T 5: 24,416,999 Y419F probably benign Het
Atg7 A G 6: 114,695,663 Y279C probably damaging Het
Braf G A 6: 39,623,676 P616L probably damaging Het
Btnl2 T C 17: 34,358,135 M88T possibly damaging Het
C1rb T A 6: 124,580,661 Y586N probably damaging Het
Cacna1s T C 1: 136,069,042 F127S possibly damaging Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cox8b T A 7: 140,899,005 K66* probably null Het
Diras2 T A 13: 52,508,023 I83F probably damaging Het
Dlg2 T A 7: 91,711,800 probably null Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Dolpp1 T C 2: 30,397,488 L204P probably damaging Het
Fam170a C T 18: 50,282,204 P306S probably benign Het
Fam205a1 T C 4: 42,851,472 E228G probably benign Het
Fbxl12 A T 9: 20,638,972 probably null Het
Fndc3a T A 14: 72,540,208 I1186F probably benign Het
Gm12886 T A 4: 121,417,470 D71V probably damaging Het
Hist1h3g T C 13: 23,535,552 V36A possibly damaging Het
Ica1 A G 6: 8,659,021 probably benign Het
Ighv8-11 A G 12: 115,567,151 I119T possibly damaging Het
Ism1 A T 2: 139,732,011 R94* probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kcnk15 T C 2: 163,858,294 L132P probably damaging Het
Lrmda T A 14: 22,027,331 probably benign Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mkl2 C T 16: 13,385,693 A201V probably damaging Het
Ncstn G A 1: 172,067,895 T562M possibly damaging Het
Nudt4 A T 10: 95,549,505 probably null Het
Olfr1248 A T 2: 89,618,159 I11N possibly damaging Het
Olfr958 A C 9: 39,550,122 C250G probably damaging Het
Omp T C 7: 98,145,213 N69S probably benign Het
Pak1 C T 7: 97,854,497 P13L probably damaging Het
Pde4d T A 13: 109,951,332 C744* probably null Het
Pelp1 T C 11: 70,398,200 Y240C possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Ptprk A G 10: 28,383,623 D353G probably damaging Het
Ptprs A G 17: 56,417,485 F1152S probably damaging Het
Rnf135 G T 11: 80,196,917 A231S probably benign Het
Rpn1 G A 6: 88,090,300 probably null Het
Rreb1 T A 13: 37,947,098 D1409E probably benign Het
Sipa1l2 G A 8: 125,473,584 H668Y probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Slc35d1 T C 4: 103,208,124 K187E possibly damaging Het
Slc44a2 A T 9: 21,342,977 I212F possibly damaging Het
Slc7a1 G A 5: 148,335,533 R445* probably null Het
Snapc4 A G 2: 26,365,428 L1028P probably benign Het
Snrnp40 C T 4: 130,368,275 T152I possibly damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Tex2 C T 11: 106,546,740 W203* probably null Het
Tmcc1 T C 6: 116,133,822 E170G possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Ttll6 A G 11: 96,133,921 N46D probably benign Het
Txk T A 5: 72,707,735 K266* probably null Het
Uggt2 T C 14: 119,041,518 E859G probably damaging Het
Vps13b T A 15: 35,671,382 I1677N probably damaging Het
Zbtb5 A G 4: 44,994,863 probably null Het
Zfp760 A G 17: 21,722,162 Y106C probably damaging Het
Other mutations in Uros
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Uros APN 7 133687005 missense possibly damaging 0.87
R1960:Uros UTSW 7 133687006 missense probably benign
R4065:Uros UTSW 7 133702328 critical splice donor site probably null
R6577:Uros UTSW 7 133700840 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGGGCTGTCTTGAAAATAAGG -3'
(R):5'- TCAGTGACAGAGGGCTTGAG -3'

Sequencing Primer
(F):5'- GGGAAGTGACGTCATATTAATCACC -3'
(R):5'- CTTGAGAAAGACCAAGCCCGTTTAG -3'
Posted On2015-01-23