Incidental Mutation 'R3722:Kbtbd11'
ID258969
Institutional Source Beutler Lab
Gene Symbol Kbtbd11
Ensembl Gene ENSMUSG00000055675
Gene Namekelch repeat and BTB (POZ) domain containing 11
Synonyms4930465M17Rik, 2900016B01Rik
MMRRC Submission 040713-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R3722 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location15011025-15033333 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 15029118 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 572 (C572*)
Ref Sequence ENSEMBL: ENSMUSP00000139292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069399] [ENSMUST00000183471]
Predicted Effect probably null
Transcript: ENSMUST00000069399
AA Change: C572*
SMART Domains Protein: ENSMUSP00000068321
Gene: ENSMUSG00000055675
AA Change: C572*

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 88 114 N/A INTRINSIC
BTB 146 237 1.74e-15 SMART
low complexity region 289 311 N/A INTRINSIC
Blast:BTB 318 358 2e-16 BLAST
Kelch 366 418 5.26e-3 SMART
Kelch 419 463 4.65e-4 SMART
Kelch 464 506 1.71e-1 SMART
low complexity region 524 532 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183471
AA Change: C572*
SMART Domains Protein: ENSMUSP00000139292
Gene: ENSMUSG00000055675
AA Change: C572*

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
low complexity region 88 114 N/A INTRINSIC
BTB 146 237 1.74e-15 SMART
low complexity region 289 311 N/A INTRINSIC
Blast:BTB 318 358 2e-16 BLAST
Kelch 366 418 5.26e-3 SMART
Kelch 419 463 4.65e-4 SMART
Kelch 464 506 1.71e-1 SMART
low complexity region 524 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192473
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,340,510 S1485T probably benign Het
Akap9 A G 5: 4,070,351 Y3589C probably damaging Het
Alkbh8 T C 9: 3,385,153 Y482H probably damaging Het
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Arhgap21 T C 2: 20,850,291 E1420G probably damaging Het
Asic3 A T 5: 24,416,999 Y419F probably benign Het
Atg7 A G 6: 114,695,663 Y279C probably damaging Het
Braf G A 6: 39,623,676 P616L probably damaging Het
Btnl2 T C 17: 34,358,135 M88T possibly damaging Het
C1rb T A 6: 124,580,661 Y586N probably damaging Het
Cacna1s T C 1: 136,069,042 F127S possibly damaging Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cox8b T A 7: 140,899,005 K66* probably null Het
Diras2 T A 13: 52,508,023 I83F probably damaging Het
Dlg2 T A 7: 91,711,800 probably null Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Dolpp1 T C 2: 30,397,488 L204P probably damaging Het
Fam170a C T 18: 50,282,204 P306S probably benign Het
Fam205a1 T C 4: 42,851,472 E228G probably benign Het
Fbxl12 A T 9: 20,638,972 probably null Het
Fndc3a T A 14: 72,540,208 I1186F probably benign Het
Gm12886 T A 4: 121,417,470 D71V probably damaging Het
Hist1h3g T C 13: 23,535,552 V36A possibly damaging Het
Ica1 A G 6: 8,659,021 probably benign Het
Ighv8-11 A G 12: 115,567,151 I119T possibly damaging Het
Ism1 A T 2: 139,732,011 R94* probably null Het
Kcnk15 T C 2: 163,858,294 L132P probably damaging Het
Lrmda T A 14: 22,027,331 probably benign Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mkl2 C T 16: 13,385,693 A201V probably damaging Het
Ncstn G A 1: 172,067,895 T562M possibly damaging Het
Nudt4 A T 10: 95,549,505 probably null Het
Olfr1248 A T 2: 89,618,159 I11N possibly damaging Het
Olfr958 A C 9: 39,550,122 C250G probably damaging Het
Omp T C 7: 98,145,213 N69S probably benign Het
Pak1 C T 7: 97,854,497 P13L probably damaging Het
Pde4d T A 13: 109,951,332 C744* probably null Het
Pelp1 T C 11: 70,398,200 Y240C possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Ptprk A G 10: 28,383,623 D353G probably damaging Het
Ptprs A G 17: 56,417,485 F1152S probably damaging Het
Rnf135 G T 11: 80,196,917 A231S probably benign Het
Rpn1 G A 6: 88,090,300 probably null Het
Rreb1 T A 13: 37,947,098 D1409E probably benign Het
Sipa1l2 G A 8: 125,473,584 H668Y probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Slc35d1 T C 4: 103,208,124 K187E possibly damaging Het
Slc44a2 A T 9: 21,342,977 I212F possibly damaging Het
Slc7a1 G A 5: 148,335,533 R445* probably null Het
Snapc4 A G 2: 26,365,428 L1028P probably benign Het
Snrnp40 C T 4: 130,368,275 T152I possibly damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Tex2 C T 11: 106,546,740 W203* probably null Het
Tmcc1 T C 6: 116,133,822 E170G possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Ttll6 A G 11: 96,133,921 N46D probably benign Het
Txk T A 5: 72,707,735 K266* probably null Het
Uggt2 T C 14: 119,041,518 E859G probably damaging Het
Uros A T 7: 133,702,391 M1K probably null Het
Vps13b T A 15: 35,671,382 I1677N probably damaging Het
Zbtb5 A G 4: 44,994,863 probably null Het
Zfp760 A G 17: 21,722,162 Y106C probably damaging Het
Other mutations in Kbtbd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Kbtbd11 APN 8 15029176 missense probably damaging 1.00
IGL02160:Kbtbd11 APN 8 15028801 missense probably damaging 1.00
IGL02538:Kbtbd11 APN 8 15028841 missense probably damaging 1.00
IGL03039:Kbtbd11 APN 8 15027467 missense probably benign 0.00
R0152:Kbtbd11 UTSW 8 15027428 missense probably damaging 0.96
R0242:Kbtbd11 UTSW 8 15027508 missense probably benign
R0242:Kbtbd11 UTSW 8 15027508 missense probably benign
R0453:Kbtbd11 UTSW 8 15027499 missense probably benign 0.01
R0498:Kbtbd11 UTSW 8 15027605 missense probably benign
R0629:Kbtbd11 UTSW 8 15027572 missense probably benign
R2031:Kbtbd11 UTSW 8 15028021 missense possibly damaging 0.87
R2214:Kbtbd11 UTSW 8 15029178 missense possibly damaging 0.85
R3720:Kbtbd11 UTSW 8 15029118 nonsense probably null
R4355:Kbtbd11 UTSW 8 15028578 missense probably damaging 1.00
R4658:Kbtbd11 UTSW 8 15028917 missense possibly damaging 0.59
R5037:Kbtbd11 UTSW 8 15027886 missense probably benign 0.25
R5312:Kbtbd11 UTSW 8 15028589 missense possibly damaging 0.92
R5936:Kbtbd11 UTSW 8 15027534 missense probably benign 0.00
R6056:Kbtbd11 UTSW 8 15027577 missense probably benign
R6272:Kbtbd11 UTSW 8 15029118 nonsense probably null
R6547:Kbtbd11 UTSW 8 15027641 missense possibly damaging 0.83
R7126:Kbtbd11 UTSW 8 15028759 missense probably damaging 1.00
R7359:Kbtbd11 UTSW 8 15028858 missense probably damaging 1.00
Z1088:Kbtbd11 UTSW 8 15027839 missense probably damaging 1.00
Z1177:Kbtbd11 UTSW 8 15027694 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCTACCGCCTGCTCAAGTAC -3'
(R):5'- GATCCTGTCCTAGACTGCAC -3'

Sequencing Primer
(F):5'- GCCTGCTCAAGTACGACCC -3'
(R):5'- GTCCTAGACTGCACCCTGC -3'
Posted On2015-01-23