Incidental Mutation 'R3722:Sipa1l2'
ID258970
Institutional Source Beutler Lab
Gene Symbol Sipa1l2
Ensembl Gene ENSMUSG00000001995
Gene Namesignal-induced proliferation-associated 1 like 2
Synonyms
MMRRC Submission 040713-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R3722 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location125418063-125569808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 125473584 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 668 (H668Y)
Ref Sequence ENSEMBL: ENSMUSP00000148536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108775] [ENSMUST00000212168] [ENSMUST00000212987]
Predicted Effect probably damaging
Transcript: ENSMUST00000108775
AA Change: H668Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104405
Gene: ENSMUSG00000001995
AA Change: H668Y

DomainStartEndE-ValueType
low complexity region 53 64 N/A INTRINSIC
low complexity region 163 172 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
low complexity region 427 449 N/A INTRINSIC
Pfam:Rap_GAP 625 807 2.6e-67 PFAM
PDZ 960 1026 6.47e-9 SMART
low complexity region 1091 1103 N/A INTRINSIC
low complexity region 1120 1138 N/A INTRINSIC
low complexity region 1220 1238 N/A INTRINSIC
low complexity region 1299 1312 N/A INTRINSIC
low complexity region 1321 1329 N/A INTRINSIC
low complexity region 1334 1355 N/A INTRINSIC
low complexity region 1404 1418 N/A INTRINSIC
Pfam:SPAR_C 1421 1666 2.5e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000212168
AA Change: H668Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000212987
AA Change: H668Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6356 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the signal-induced proliferation-associated 1 like family. Members of this family contain a GTPase activating domain, a PDZ domain and a C-terminal coiled-coil domain with a leucine zipper. A similar protein in rat acts as a GTPases for the small GTPase Rap. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,340,510 S1485T probably benign Het
Akap9 A G 5: 4,070,351 Y3589C probably damaging Het
Alkbh8 T C 9: 3,385,153 Y482H probably damaging Het
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Arhgap21 T C 2: 20,850,291 E1420G probably damaging Het
Asic3 A T 5: 24,416,999 Y419F probably benign Het
Atg7 A G 6: 114,695,663 Y279C probably damaging Het
Braf G A 6: 39,623,676 P616L probably damaging Het
Btnl2 T C 17: 34,358,135 M88T possibly damaging Het
C1rb T A 6: 124,580,661 Y586N probably damaging Het
Cacna1s T C 1: 136,069,042 F127S possibly damaging Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cox8b T A 7: 140,899,005 K66* probably null Het
Diras2 T A 13: 52,508,023 I83F probably damaging Het
Dlg2 T A 7: 91,711,800 probably null Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Dolpp1 T C 2: 30,397,488 L204P probably damaging Het
Fam170a C T 18: 50,282,204 P306S probably benign Het
Fam205a1 T C 4: 42,851,472 E228G probably benign Het
Fbxl12 A T 9: 20,638,972 probably null Het
Fndc3a T A 14: 72,540,208 I1186F probably benign Het
Gm12886 T A 4: 121,417,470 D71V probably damaging Het
Hist1h3g T C 13: 23,535,552 V36A possibly damaging Het
Ica1 A G 6: 8,659,021 probably benign Het
Ighv8-11 A G 12: 115,567,151 I119T possibly damaging Het
Ism1 A T 2: 139,732,011 R94* probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kcnk15 T C 2: 163,858,294 L132P probably damaging Het
Lrmda T A 14: 22,027,331 probably benign Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mkl2 C T 16: 13,385,693 A201V probably damaging Het
Ncstn G A 1: 172,067,895 T562M possibly damaging Het
Nudt4 A T 10: 95,549,505 probably null Het
Olfr1248 A T 2: 89,618,159 I11N possibly damaging Het
Olfr958 A C 9: 39,550,122 C250G probably damaging Het
Omp T C 7: 98,145,213 N69S probably benign Het
Pak1 C T 7: 97,854,497 P13L probably damaging Het
Pde4d T A 13: 109,951,332 C744* probably null Het
Pelp1 T C 11: 70,398,200 Y240C possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Ptprk A G 10: 28,383,623 D353G probably damaging Het
Ptprs A G 17: 56,417,485 F1152S probably damaging Het
Rnf135 G T 11: 80,196,917 A231S probably benign Het
Rpn1 G A 6: 88,090,300 probably null Het
Rreb1 T A 13: 37,947,098 D1409E probably benign Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Slc35d1 T C 4: 103,208,124 K187E possibly damaging Het
Slc44a2 A T 9: 21,342,977 I212F possibly damaging Het
Slc7a1 G A 5: 148,335,533 R445* probably null Het
Snapc4 A G 2: 26,365,428 L1028P probably benign Het
Snrnp40 C T 4: 130,368,275 T152I possibly damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Tex2 C T 11: 106,546,740 W203* probably null Het
Tmcc1 T C 6: 116,133,822 E170G possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Ttll6 A G 11: 96,133,921 N46D probably benign Het
Txk T A 5: 72,707,735 K266* probably null Het
Uggt2 T C 14: 119,041,518 E859G probably damaging Het
Uros A T 7: 133,702,391 M1K probably null Het
Vps13b T A 15: 35,671,382 I1677N probably damaging Het
Zbtb5 A G 4: 44,994,863 probably null Het
Zfp760 A G 17: 21,722,162 Y106C probably damaging Het
Other mutations in Sipa1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Sipa1l2 APN 8 125491806 missense probably damaging 1.00
IGL00939:Sipa1l2 APN 8 125464435 splice site probably benign
IGL00965:Sipa1l2 APN 8 125447874 missense probably benign 0.02
IGL01321:Sipa1l2 APN 8 125491518 missense probably damaging 1.00
IGL01450:Sipa1l2 APN 8 125422577 critical splice donor site probably null
IGL01753:Sipa1l2 APN 8 125453292 splice site probably benign
IGL01930:Sipa1l2 APN 8 125419239 missense probably damaging 0.99
IGL02041:Sipa1l2 APN 8 125491819 missense probably benign 0.03
IGL02215:Sipa1l2 APN 8 125447837 missense possibly damaging 0.67
IGL02272:Sipa1l2 APN 8 125492011 missense probably damaging 1.00
IGL02370:Sipa1l2 APN 8 125480269 missense probably damaging 1.00
IGL02538:Sipa1l2 APN 8 125451977 missense probably damaging 1.00
IGL02633:Sipa1l2 APN 8 125447768 missense probably damaging 1.00
IGL03394:Sipa1l2 APN 8 125491659 missense possibly damaging 0.67
rebellious UTSW 8 125468339 missense probably benign 0.01
R0144:Sipa1l2 UTSW 8 125449876 splice site probably null
R0153:Sipa1l2 UTSW 8 125421898 missense probably damaging 0.99
R0276:Sipa1l2 UTSW 8 125421940 missense probably damaging 1.00
R0318:Sipa1l2 UTSW 8 125447697 missense possibly damaging 0.73
R0373:Sipa1l2 UTSW 8 125464410 missense probably damaging 0.99
R0427:Sipa1l2 UTSW 8 125480332 missense probably damaging 1.00
R0634:Sipa1l2 UTSW 8 125422624 nonsense probably null
R1377:Sipa1l2 UTSW 8 125491977 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1404:Sipa1l2 UTSW 8 125449973 missense probably damaging 1.00
R1435:Sipa1l2 UTSW 8 125468725 missense probably damaging 1.00
R1523:Sipa1l2 UTSW 8 125447613 missense possibly damaging 0.75
R1577:Sipa1l2 UTSW 8 125492262 missense probably benign 0.00
R1581:Sipa1l2 UTSW 8 125491617 missense probably damaging 0.96
R1583:Sipa1l2 UTSW 8 125421895 missense probably damaging 0.97
R1719:Sipa1l2 UTSW 8 125444535 missense probably damaging 0.99
R1730:Sipa1l2 UTSW 8 125480141 splice site probably null
R1940:Sipa1l2 UTSW 8 125480148 splice site probably benign
R2007:Sipa1l2 UTSW 8 125439437 missense probably damaging 1.00
R2141:Sipa1l2 UTSW 8 125491491 missense probably benign 0.07
R2203:Sipa1l2 UTSW 8 125491627 missense probably damaging 0.99
R2764:Sipa1l2 UTSW 8 125492374 missense probably damaging 0.99
R3787:Sipa1l2 UTSW 8 125423205 missense probably benign
R3787:Sipa1l2 UTSW 8 125450383 missense possibly damaging 0.52
R4106:Sipa1l2 UTSW 8 125492308 missense probably damaging 1.00
R4117:Sipa1l2 UTSW 8 125468510 missense probably damaging 1.00
R4194:Sipa1l2 UTSW 8 125491672 missense probably benign 0.00
R4237:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4240:Sipa1l2 UTSW 8 125491656 missense probably benign 0.44
R4448:Sipa1l2 UTSW 8 125492355 missense probably damaging 1.00
R4515:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4519:Sipa1l2 UTSW 8 125492226 missense probably benign 0.00
R4523:Sipa1l2 UTSW 8 125492424 missense probably damaging 1.00
R4557:Sipa1l2 UTSW 8 125464415 missense probably damaging 0.98
R4667:Sipa1l2 UTSW 8 125453470 missense possibly damaging 0.93
R4687:Sipa1l2 UTSW 8 125491245 missense probably damaging 1.00
R4854:Sipa1l2 UTSW 8 125473601 missense probably damaging 1.00
R4890:Sipa1l2 UTSW 8 125491867 missense probably damaging 1.00
R5065:Sipa1l2 UTSW 8 125491585 missense probably benign 0.19
R5194:Sipa1l2 UTSW 8 125439273 missense possibly damaging 0.48
R5266:Sipa1l2 UTSW 8 125492126 missense probably damaging 0.99
R5475:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R5718:Sipa1l2 UTSW 8 125491248 missense probably damaging 1.00
R5910:Sipa1l2 UTSW 8 125491684 missense probably benign 0.42
R5916:Sipa1l2 UTSW 8 125468573 missense probably damaging 1.00
R5941:Sipa1l2 UTSW 8 125473536 missense probably damaging 0.99
R6083:Sipa1l2 UTSW 8 125468473 missense possibly damaging 0.87
R6185:Sipa1l2 UTSW 8 125468253 nonsense probably null
R6235:Sipa1l2 UTSW 8 125474871 missense probably damaging 1.00
R6274:Sipa1l2 UTSW 8 125469872 missense probably damaging 1.00
R6299:Sipa1l2 UTSW 8 125453464 missense possibly damaging 0.75
R6374:Sipa1l2 UTSW 8 125444630 missense probably damaging 1.00
R6459:Sipa1l2 UTSW 8 125444484 critical splice donor site probably null
R6462:Sipa1l2 UTSW 8 125491230 missense probably damaging 1.00
R6496:Sipa1l2 UTSW 8 125449894 missense probably benign 0.00
R6543:Sipa1l2 UTSW 8 125450362 missense possibly damaging 0.50
R7154:Sipa1l2 UTSW 8 125468339 missense probably benign 0.01
R7192:Sipa1l2 UTSW 8 125422609 missense probably benign 0.09
R7240:Sipa1l2 UTSW 8 125469860 missense probably damaging 1.00
R7361:Sipa1l2 UTSW 8 125453332 missense probably damaging 1.00
R7383:Sipa1l2 UTSW 8 125447646 missense probably damaging 1.00
R7417:Sipa1l2 UTSW 8 125482106 missense possibly damaging 0.93
R7604:Sipa1l2 UTSW 8 125419272 missense probably benign 0.45
R7658:Sipa1l2 UTSW 8 125492290 missense probably benign 0.00
R7743:Sipa1l2 UTSW 8 125464233 missense probably damaging 1.00
R7781:Sipa1l2 UTSW 8 125491827 missense possibly damaging 0.46
R7812:Sipa1l2 UTSW 8 125491595 missense probably damaging 1.00
R7829:Sipa1l2 UTSW 8 125451988 missense probably damaging 1.00
R7880:Sipa1l2 UTSW 8 125464393 missense probably damaging 1.00
R7884:Sipa1l2 UTSW 8 125447598 missense probably benign
R7963:Sipa1l2 UTSW 8 125464393 missense probably damaging 1.00
R7967:Sipa1l2 UTSW 8 125447598 missense probably benign
R8057:Sipa1l2 UTSW 8 125468530 missense probably damaging 1.00
X0027:Sipa1l2 UTSW 8 125492136 missense probably damaging 1.00
Z1177:Sipa1l2 UTSW 8 125447556 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TGTCAGCATACTAGGAACAGC -3'
(R):5'- TCCAGGTGAGAGCTGATAACAG -3'

Sequencing Primer
(F):5'- GCCTCCGACTTCTAAATCGAG -3'
(R):5'- CTGATAACAGCTGAGCAGAGG -3'
Posted On2015-01-23