Incidental Mutation 'R3722:Alkbh8'
ID258971
Institutional Source Beutler Lab
Gene Symbol Alkbh8
Ensembl Gene ENSMUSG00000025899
Gene NamealkB homolog 8, tRNA methyltransferase
Synonyms4930562C03Rik, Abh8, 9430088N01Rik, 8030431D03Rik
MMRRC Submission 040713-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3722 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location3335140-3391154 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3385153 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 482 (Y482H)
Ref Sequence ENSEMBL: ENSMUSP00000148380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053407] [ENSMUST00000165105] [ENSMUST00000211933] [ENSMUST00000212294] [ENSMUST00000212358]
Predicted Effect probably damaging
Transcript: ENSMUST00000053407
AA Change: Y517H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061511
Gene: ENSMUSG00000025899
AA Change: Y517H

DomainStartEndE-ValueType
Pfam:DUF1891 1 37 4.9e-18 PFAM
RRM 44 116 1.64e-2 SMART
Pfam:2OG-FeII_Oxy_2 136 334 8.7e-27 PFAM
Pfam:2OG-FeII_Oxy 220 336 1.8e-11 PFAM
Pfam:Methyltransf_8 359 522 4.5e-8 PFAM
Pfam:Methyltransf_23 386 534 1e-9 PFAM
Pfam:Methyltransf_31 404 547 3.5e-8 PFAM
Pfam:Methyltransf_25 410 497 1.7e-9 PFAM
Pfam:Methyltransf_11 411 501 5.5e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000165105
AA Change: Y517H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125996
Gene: ENSMUSG00000025899
AA Change: Y517H

DomainStartEndE-ValueType
Pfam:DUF1891 1 37 4.9e-18 PFAM
RRM 44 116 1.64e-2 SMART
Pfam:2OG-FeII_Oxy_2 136 334 1.6e-24 PFAM
Pfam:Methyltransf_8 359 522 4.5e-8 PFAM
Pfam:Methyltransf_25 410 497 1.5e-9 PFAM
Pfam:Methyltransf_11 411 501 1.8e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211933
AA Change: Y517H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212294
AA Change: Y482H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000212358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212955
Meta Mutation Damage Score 0.1841 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (61/62)
MGI Phenotype PHENOTYPE: Homozygous mutants show no obvious phenotype at 20 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,340,510 S1485T probably benign Het
Akap9 A G 5: 4,070,351 Y3589C probably damaging Het
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Arhgap21 T C 2: 20,850,291 E1420G probably damaging Het
Asic3 A T 5: 24,416,999 Y419F probably benign Het
Atg7 A G 6: 114,695,663 Y279C probably damaging Het
Braf G A 6: 39,623,676 P616L probably damaging Het
Btnl2 T C 17: 34,358,135 M88T possibly damaging Het
C1rb T A 6: 124,580,661 Y586N probably damaging Het
Cacna1s T C 1: 136,069,042 F127S possibly damaging Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cox8b T A 7: 140,899,005 K66* probably null Het
Diras2 T A 13: 52,508,023 I83F probably damaging Het
Dlg2 T A 7: 91,711,800 probably null Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Dolpp1 T C 2: 30,397,488 L204P probably damaging Het
Fam170a C T 18: 50,282,204 P306S probably benign Het
Fam205a1 T C 4: 42,851,472 E228G probably benign Het
Fbxl12 A T 9: 20,638,972 probably null Het
Fndc3a T A 14: 72,540,208 I1186F probably benign Het
Gm12886 T A 4: 121,417,470 D71V probably damaging Het
Hist1h3g T C 13: 23,535,552 V36A possibly damaging Het
Ica1 A G 6: 8,659,021 probably benign Het
Ighv8-11 A G 12: 115,567,151 I119T possibly damaging Het
Ism1 A T 2: 139,732,011 R94* probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kcnk15 T C 2: 163,858,294 L132P probably damaging Het
Lrmda T A 14: 22,027,331 probably benign Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mkl2 C T 16: 13,385,693 A201V probably damaging Het
Ncstn G A 1: 172,067,895 T562M possibly damaging Het
Nudt4 A T 10: 95,549,505 probably null Het
Olfr1248 A T 2: 89,618,159 I11N possibly damaging Het
Olfr958 A C 9: 39,550,122 C250G probably damaging Het
Omp T C 7: 98,145,213 N69S probably benign Het
Pak1 C T 7: 97,854,497 P13L probably damaging Het
Pde4d T A 13: 109,951,332 C744* probably null Het
Pelp1 T C 11: 70,398,200 Y240C possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Ptprk A G 10: 28,383,623 D353G probably damaging Het
Ptprs A G 17: 56,417,485 F1152S probably damaging Het
Rnf135 G T 11: 80,196,917 A231S probably benign Het
Rpn1 G A 6: 88,090,300 probably null Het
Rreb1 T A 13: 37,947,098 D1409E probably benign Het
Sipa1l2 G A 8: 125,473,584 H668Y probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Slc35d1 T C 4: 103,208,124 K187E possibly damaging Het
Slc44a2 A T 9: 21,342,977 I212F possibly damaging Het
Slc7a1 G A 5: 148,335,533 R445* probably null Het
Snapc4 A G 2: 26,365,428 L1028P probably benign Het
Snrnp40 C T 4: 130,368,275 T152I possibly damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Tex2 C T 11: 106,546,740 W203* probably null Het
Tmcc1 T C 6: 116,133,822 E170G possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Ttll6 A G 11: 96,133,921 N46D probably benign Het
Txk T A 5: 72,707,735 K266* probably null Het
Uggt2 T C 14: 119,041,518 E859G probably damaging Het
Uros A T 7: 133,702,391 M1K probably null Het
Vps13b T A 15: 35,671,382 I1677N probably damaging Het
Zbtb5 A G 4: 44,994,863 probably null Het
Zfp760 A G 17: 21,722,162 Y106C probably damaging Het
Other mutations in Alkbh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00705:Alkbh8 APN 9 3359588 missense probably damaging 1.00
IGL01419:Alkbh8 APN 9 3385354 missense probably damaging 1.00
IGL01457:Alkbh8 APN 9 3369825 missense probably damaging 1.00
IGL02398:Alkbh8 APN 9 3345870 missense possibly damaging 0.77
IGL02503:Alkbh8 APN 9 3347852 missense probably damaging 1.00
IGL02824:Alkbh8 APN 9 3368021 splice site probably null
IGL03001:Alkbh8 APN 9 3344602 missense probably benign
IGL03055:Alkbh8 APN 9 3345882 splice site probably benign
R0046:Alkbh8 UTSW 9 3343247 missense probably damaging 1.00
R0046:Alkbh8 UTSW 9 3343247 missense probably damaging 1.00
R0403:Alkbh8 UTSW 9 3385469 missense probably damaging 1.00
R1331:Alkbh8 UTSW 9 3347916 unclassified probably null
R1688:Alkbh8 UTSW 9 3382765 missense probably damaging 1.00
R1859:Alkbh8 UTSW 9 3385499 missense probably benign 0.07
R2014:Alkbh8 UTSW 9 3343216 nonsense probably null
R3016:Alkbh8 UTSW 9 3369658 missense probably benign 0.08
R4744:Alkbh8 UTSW 9 3344604 nonsense probably null
R4840:Alkbh8 UTSW 9 3369751 missense probably damaging 1.00
R5403:Alkbh8 UTSW 9 3385318 missense probably benign 0.00
R5644:Alkbh8 UTSW 9 3385384 missense probably damaging 1.00
R5677:Alkbh8 UTSW 9 3385147 missense possibly damaging 0.93
R5902:Alkbh8 UTSW 9 3385414 missense probably benign 0.04
R6293:Alkbh8 UTSW 9 3347841 missense possibly damaging 0.52
R7352:Alkbh8 UTSW 9 3345796 missense probably damaging 0.99
R7457:Alkbh8 UTSW 9 3343056 missense probably damaging 0.99
R7869:Alkbh8 UTSW 9 3359503 missense probably damaging 1.00
R7887:Alkbh8 UTSW 9 3385343 missense probably damaging 0.99
R7952:Alkbh8 UTSW 9 3359503 missense probably damaging 1.00
R7970:Alkbh8 UTSW 9 3385343 missense probably damaging 0.99
R8052:Alkbh8 UTSW 9 3385478 missense probably damaging 1.00
X0028:Alkbh8 UTSW 9 3369767 missense probably benign 0.01
X0062:Alkbh8 UTSW 9 3359532 missense probably null 1.00
Z1176:Alkbh8 UTSW 9 3345820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTTGAGCACCAGCAAACAG -3'
(R):5'- CTTGGGAATGAAAGCAGGTCC -3'

Sequencing Primer
(F):5'- TTTGAGCACCAGCAAACAGTTATAC -3'
(R):5'- TGAATAGGGAGTTCAGAATTAGGAAC -3'
Posted On2015-01-23