Incidental Mutation 'R3722:Adgb'
ID258975
Institutional Source Beutler Lab
Gene Symbol Adgb
Ensembl Gene ENSMUSG00000050994
Gene Nameandroglobin
Synonyms9130014G24Rik
MMRRC Submission 040713-MU
Accession Numbers

MGI:3605549

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3722 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location10335703-10472326 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10340510 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1485 (S1485T)
Ref Sequence ENSEMBL: ENSMUSP00000146658 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118589
Predicted Effect probably benign
Transcript: ENSMUST00000148816
SMART Domains Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994

DomainStartEndE-ValueType
Blast:CysPc 1 41 1e-19 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172530
AA Change: S1509T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: S1509T

DomainStartEndE-ValueType
CysPc 56 655 2.7e-2 SMART
IQ 904 926 6.41e0 SMART
low complexity region 1179 1190 N/A INTRINSIC
low complexity region 1318 1335 N/A INTRINSIC
coiled coil region 1534 1559 N/A INTRINSIC
low complexity region 1616 1633 N/A INTRINSIC
low complexity region 1649 1657 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179956
AA Change: S1512T

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: S1512T

DomainStartEndE-ValueType
CysPc 56 657 5.36e-2 SMART
IQ 906 928 6.41e0 SMART
low complexity region 1181 1192 N/A INTRINSIC
low complexity region 1321 1338 N/A INTRINSIC
coiled coil region 1537 1562 N/A INTRINSIC
low complexity region 1619 1636 N/A INTRINSIC
low complexity region 1652 1660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000208717
AA Change: S1485T

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0766 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 A G 5: 4,070,351 Y3589C probably damaging Het
Alkbh8 T C 9: 3,385,153 Y482H probably damaging Het
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Arhgap21 T C 2: 20,850,291 E1420G probably damaging Het
Asic3 A T 5: 24,416,999 Y419F probably benign Het
Atg7 A G 6: 114,695,663 Y279C probably damaging Het
Braf G A 6: 39,623,676 P616L probably damaging Het
Btnl2 T C 17: 34,358,135 M88T possibly damaging Het
C1rb T A 6: 124,580,661 Y586N probably damaging Het
Cacna1s T C 1: 136,069,042 F127S possibly damaging Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cox8b T A 7: 140,899,005 K66* probably null Het
Diras2 T A 13: 52,508,023 I83F probably damaging Het
Dlg2 T A 7: 91,711,800 probably null Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Dolpp1 T C 2: 30,397,488 L204P probably damaging Het
Fam170a C T 18: 50,282,204 P306S probably benign Het
Fam205a1 T C 4: 42,851,472 E228G probably benign Het
Fbxl12 A T 9: 20,638,972 probably null Het
Fndc3a T A 14: 72,540,208 I1186F probably benign Het
Gm12886 T A 4: 121,417,470 D71V probably damaging Het
Hist1h3g T C 13: 23,535,552 V36A possibly damaging Het
Ica1 A G 6: 8,659,021 probably benign Het
Ighv8-11 A G 12: 115,567,151 I119T possibly damaging Het
Ism1 A T 2: 139,732,011 R94* probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kcnk15 T C 2: 163,858,294 L132P probably damaging Het
Lrmda T A 14: 22,027,331 probably benign Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mkl2 C T 16: 13,385,693 A201V probably damaging Het
Ncstn G A 1: 172,067,895 T562M possibly damaging Het
Nudt4 A T 10: 95,549,505 probably null Het
Olfr1248 A T 2: 89,618,159 I11N possibly damaging Het
Olfr958 A C 9: 39,550,122 C250G probably damaging Het
Omp T C 7: 98,145,213 N69S probably benign Het
Pak1 C T 7: 97,854,497 P13L probably damaging Het
Pde4d T A 13: 109,951,332 C744* probably null Het
Pelp1 T C 11: 70,398,200 Y240C possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Ptprk A G 10: 28,383,623 D353G probably damaging Het
Ptprs A G 17: 56,417,485 F1152S probably damaging Het
Rnf135 G T 11: 80,196,917 A231S probably benign Het
Rpn1 G A 6: 88,090,300 probably null Het
Rreb1 T A 13: 37,947,098 D1409E probably benign Het
Sipa1l2 G A 8: 125,473,584 H668Y probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Slc35d1 T C 4: 103,208,124 K187E possibly damaging Het
Slc44a2 A T 9: 21,342,977 I212F possibly damaging Het
Slc7a1 G A 5: 148,335,533 R445* probably null Het
Snapc4 A G 2: 26,365,428 L1028P probably benign Het
Snrnp40 C T 4: 130,368,275 T152I possibly damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Tex2 C T 11: 106,546,740 W203* probably null Het
Tmcc1 T C 6: 116,133,822 E170G possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Ttll6 A G 11: 96,133,921 N46D probably benign Het
Txk T A 5: 72,707,735 K266* probably null Het
Uggt2 T C 14: 119,041,518 E859G probably damaging Het
Uros A T 7: 133,702,391 M1K probably null Het
Vps13b T A 15: 35,671,382 I1677N probably damaging Het
Zbtb5 A G 4: 44,994,863 probably null Het
Zfp760 A G 17: 21,722,162 Y106C probably damaging Het
Other mutations in Adgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Adgb APN 10 10406099 missense possibly damaging 0.87
IGL01083:Adgb APN 10 10407554 missense possibly damaging 0.50
IGL03064:Adgb APN 10 10400572 missense probably benign 0.02
R0080:Adgb UTSW 10 10377839 splice site probably benign
R0084:Adgb UTSW 10 10396344 missense possibly damaging 0.74
R0112:Adgb UTSW 10 10407158 splice site probably benign
R0348:Adgb UTSW 10 10357879 missense probably benign
R0415:Adgb UTSW 10 10431067 splice site probably null
R0633:Adgb UTSW 10 10391729 missense probably benign 0.36
R1052:Adgb UTSW 10 10442613 missense probably benign 0.29
R1248:Adgb UTSW 10 10395310 missense probably damaging 0.98
R1278:Adgb UTSW 10 10382828 missense probably damaging 1.00
R1568:Adgb UTSW 10 10442665 nonsense probably null
R1647:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1648:Adgb UTSW 10 10395371 missense probably damaging 1.00
R1663:Adgb UTSW 10 10339675 missense possibly damaging 0.86
R1688:Adgb UTSW 10 10350317 nonsense probably null
R1758:Adgb UTSW 10 10426605 missense probably damaging 1.00
R1772:Adgb UTSW 10 10382721 splice site probably benign
R1850:Adgb UTSW 10 10442502 missense probably damaging 1.00
R1959:Adgb UTSW 10 10395249 missense probably benign 0.02
R1980:Adgb UTSW 10 10433498 missense probably benign
R2179:Adgb UTSW 10 10395274 missense possibly damaging 0.94
R2229:Adgb UTSW 10 10436051 missense probably damaging 1.00
R2283:Adgb UTSW 10 10377891 missense probably damaging 0.99
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2870:Adgb UTSW 10 10431281 critical splice donor site probably null
R2875:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2876:Adgb UTSW 10 10422719 missense probably damaging 1.00
R2920:Adgb UTSW 10 10390243 missense probably damaging 1.00
R2931:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R3846:Adgb UTSW 10 10382721 splice site probably benign
R3877:Adgb UTSW 10 10442483 critical splice donor site probably null
R4210:Adgb UTSW 10 10407465 missense probably benign 0.06
R4211:Adgb UTSW 10 10407465 missense probably benign 0.06
R4333:Adgb UTSW 10 10442502 missense possibly damaging 0.84
R4448:Adgb UTSW 10 10390825 missense probably benign 0.32
R4470:Adgb UTSW 10 10398951 missense probably benign 0.02
R4624:Adgb UTSW 10 10403004 missense probably benign 0.00
R4656:Adgb UTSW 10 10405306 missense probably damaging 0.99
R4676:Adgb UTSW 10 10426710 missense probably damaging 1.00
R4792:Adgb UTSW 10 10398903 missense probably damaging 0.96
R4795:Adgb UTSW 10 10357872 missense probably benign 0.01
R4858:Adgb UTSW 10 10349577 missense probably damaging 1.00
R4985:Adgb UTSW 10 10400632 missense possibly damaging 0.69
R5057:Adgb UTSW 10 10357978 missense probably benign 0.11
R5157:Adgb UTSW 10 10398966 missense probably damaging 1.00
R5209:Adgb UTSW 10 10398937 missense possibly damaging 0.71
R5339:Adgb UTSW 10 10442606 missense probably damaging 1.00
R5376:Adgb UTSW 10 10346563 missense probably benign 0.09
R5426:Adgb UTSW 10 10350260 missense probably benign 0.14
R5516:Adgb UTSW 10 10431157 missense probably damaging 1.00
R5554:Adgb UTSW 10 10340473 missense probably damaging 0.98
R5678:Adgb UTSW 10 10431326 missense possibly damaging 0.83
R5707:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5708:Adgb UTSW 10 10391757 missense probably damaging 1.00
R5891:Adgb UTSW 10 10377847 nonsense probably null
R5928:Adgb UTSW 10 10378787 missense probably damaging 1.00
R6005:Adgb UTSW 10 10395352 missense probably damaging 1.00
R6017:Adgb UTSW 10 10450036 missense probably damaging 1.00
R6049:Adgb UTSW 10 10378026 missense probably damaging 1.00
R6118:Adgb UTSW 10 10431291 missense probably damaging 1.00
R6175:Adgb UTSW 10 10398943 missense possibly damaging 0.94
R6186:Adgb UTSW 10 10422758 missense probably damaging 1.00
R6234:Adgb UTSW 10 10353080 intron probably null
R6383:Adgb UTSW 10 10450028 missense probably damaging 1.00
R6522:Adgb UTSW 10 10377892 nonsense probably null
R6639:Adgb UTSW 10 10435956 missense possibly damaging 0.51
R6697:Adgb UTSW 10 10406126 nonsense probably null
R6742:Adgb UTSW 10 10411849 missense probably damaging 1.00
R6745:Adgb UTSW 10 10390197 missense probably damaging 1.00
R6850:Adgb UTSW 10 10394574 missense probably benign 0.39
R7128:Adgb UTSW 10 10472241 missense probably benign 0.26
R7326:Adgb UTSW 10 10400574 missense possibly damaging 0.80
R7386:Adgb UTSW 10 10377949 missense possibly damaging 0.52
R7431:Adgb UTSW 10 10391955 intron probably null
R7569:Adgb UTSW 10 10431252 missense probably benign
R7579:Adgb UTSW 10 10410818 nonsense probably null
R7582:Adgb UTSW 10 10390821 missense probably damaging 1.00
R7615:Adgb UTSW 10 10436010 missense probably damaging 0.96
R7692:Adgb UTSW 10 10411712 critical splice donor site probably null
R7774:Adgb UTSW 10 10339660 nonsense probably null
X0003:Adgb UTSW 10 10394630 missense possibly damaging 0.76
Z1176:Adgb UTSW 10 10378742 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCAAAGGAATTTGTTGCTGTTGC -3'
(R):5'- TAGCATGACTGTCAGACATTTCTC -3'

Sequencing Primer
(F):5'- TATGTAGCTCTAAAGTCACACACAG -3'
(R):5'- GAAGAAAGAGTCTGTTTTTCCTCC -3'
Posted On2015-01-23