Mutagenetix > Incidental Mutation

Incidental Mutation 'R3722:Adgb'

258975

Institutional Source

Beutler Lab

Gene Symbol

Adgb

Ensembl Gene

ENSMUSG00000050994

Gene Name

androglobin

Synonyms

9130014G24Rik

MMRRC Submission

040713-MU

Accession Numbers

MGI:3605549

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3722 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

10335703-10472326 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 10340510 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1485 (S1485T)

Ref Sequence

ENSEMBL: ENSMUSP00000146658 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000148816] [ENSMUST00000172530] [ENSMUST00000179956] [ENSMUST00000208717]

AlphaFold

G3UZ78

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000118589

Predicted Effect

probably benign
Transcript: ENSMUST00000148816

SMART Domains

Protein: ENSMUSP00000133652
Gene: ENSMUSG00000050994

Domain	Start	End	E-Value	Type
Blast:CysPc	1	41	1e-19	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172530
AA Change: S1509T

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000134378
Gene: ENSMUSG00000050994
AA Change: S1509T

Domain	Start	End	E-Value	Type
CysPc	56	655	2.7e-2	SMART
IQ	904	926	6.41e0	SMART
low complexity region	1179	1190	N/A	INTRINSIC
low complexity region	1318	1335	N/A	INTRINSIC
coiled coil region	1534	1559	N/A	INTRINSIC
low complexity region	1616	1633	N/A	INTRINSIC
low complexity region	1649	1657	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000179956
AA Change: S1512T

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000136386
Gene: ENSMUSG00000050994
AA Change: S1512T

Domain	Start	End	E-Value	Type
CysPc	56	657	5.36e-2	SMART
IQ	906	928	6.41e0	SMART
low complexity region	1181	1192	N/A	INTRINSIC
low complexity region	1321	1338	N/A	INTRINSIC
coiled coil region	1537	1562	N/A	INTRINSIC
low complexity region	1619	1636	N/A	INTRINSIC
low complexity region	1652	1660	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000208717
AA Change: S1485T

PolyPhen 2 Score 0.316 (Sensitivity: 0.90; Specificity: 0.89)

Meta Mutation Damage Score

0.0766

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.2%
20x: 94.9%

Validation Efficiency

98% (61/62)

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap9	A	G	5: 4,070,351	Y3589C	probably damaging	Het
Alkbh8	T	C	9: 3,385,153	Y482H	probably damaging	Het
Appl1	G	A	14: 26,927,844	T575M	probably damaging	Het
Arhgap21	T	C	2: 20,850,291	E1420G	probably damaging	Het
Asic3	A	T	5: 24,416,999	Y419F	probably benign	Het
Atg7	A	G	6: 114,695,663	Y279C	probably damaging	Het
Braf	G	A	6: 39,623,676	P616L	probably damaging	Het
Btnl2	T	C	17: 34,358,135	M88T	possibly damaging	Het
C1rb	T	A	6: 124,580,661	Y586N	probably damaging	Het
Cacna1s	T	C	1: 136,069,042	F127S	possibly damaging	Het
Cd47	A	G	16: 49,867,842	I42V	probably benign	Het
Cox8b	T	A	7: 140,899,005	K66*	probably null	Het
Diras2	T	A	13: 52,508,023	I83F	probably damaging	Het
Dlg2	T	A	7: 91,711,800		probably null	Het
Dnah8	G	A	17: 30,854,898	R4514H	probably damaging	Het
Dnaic1	G	A	4: 41,602,615	R113H	probably damaging	Het
Dolpp1	T	C	2: 30,397,488	L204P	probably damaging	Het
Fam170a	C	T	18: 50,282,204	P306S	probably benign	Het
Fam205a1	T	C	4: 42,851,472	E228G	probably benign	Het
Fbxl12	A	T	9: 20,638,972		probably null	Het
Fndc3a	T	A	14: 72,540,208	I1186F	probably benign	Het
Gm12886	T	A	4: 121,417,470	D71V	probably damaging	Het
Hist1h3g	T	C	13: 23,535,552	V36A	possibly damaging	Het
Ica1	A	G	6: 8,659,021		probably benign	Het
Ighv8-11	A	G	12: 115,567,151	I119T	possibly damaging	Het
Ism1	A	T	2: 139,732,011	R94*	probably null	Het
Kbtbd11	T	A	8: 15,029,118	C572*	probably null	Het
Kcnk15	T	C	2: 163,858,294	L132P	probably damaging	Het
Lrmda	T	A	14: 22,027,331		probably benign	Het
Mei1	A	G	15: 82,103,204	H399R	possibly damaging	Het
Mkl2	C	T	16: 13,385,693	A201V	probably damaging	Het
Ncstn	G	A	1: 172,067,895	T562M	possibly damaging	Het
Nudt4	A	T	10: 95,549,505		probably null	Het
Olfr1248	A	T	2: 89,618,159	I11N	possibly damaging	Het
Olfr958	A	C	9: 39,550,122	C250G	probably damaging	Het
Omp	T	C	7: 98,145,213	N69S	probably benign	Het
Pak1	C	T	7: 97,854,497	P13L	probably damaging	Het
Pde4d	T	A	13: 109,951,332	C744*	probably null	Het
Pelp1	T	C	11: 70,398,200	Y240C	possibly damaging	Het
Pou2f1	G	C	1: 165,894,969	P349R	probably damaging	Het
Ptprk	A	G	10: 28,383,623	D353G	probably damaging	Het
Ptprs	A	G	17: 56,417,485	F1152S	probably damaging	Het
Rnf135	G	T	11: 80,196,917	A231S	probably benign	Het
Rpn1	G	A	6: 88,090,300		probably null	Het
Rreb1	T	A	13: 37,947,098	D1409E	probably benign	Het
Sipa1l2	G	A	8: 125,473,584	H668Y	probably damaging	Het
Slc35a5	A	T	16: 45,147,322	I138N	probably damaging	Het
Slc35d1	T	C	4: 103,208,124	K187E	possibly damaging	Het
Slc44a2	A	T	9: 21,342,977	I212F	possibly damaging	Het
Slc7a1	G	A	5: 148,335,533	R445*	probably null	Het
Snapc4	A	G	2: 26,365,428	L1028P	probably benign	Het
Snrnp40	C	T	4: 130,368,275	T152I	possibly damaging	Het
Spink4	T	A	4: 40,929,136	C54S	probably damaging	Het
Tex2	C	T	11: 106,546,740	W203*	probably null	Het
Tmcc1	T	C	6: 116,133,822	E170G	possibly damaging	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Ttll6	A	G	11: 96,133,921	N46D	probably benign	Het
Txk	T	A	5: 72,707,735	K266*	probably null	Het
Uggt2	T	C	14: 119,041,518	E859G	probably damaging	Het
Uros	A	T	7: 133,702,391	M1K	probably null	Het
Vps13b	T	A	15: 35,671,382	I1677N	probably damaging	Het
Zbtb5	A	G	4: 44,994,863		probably null	Het
Zfp760	A	G	17: 21,722,162	Y106C	probably damaging	Het

Other mutations in Adgb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00503:Adgb	APN	10	10406099	missense	possibly damaging	0.87
IGL01083:Adgb	APN	10	10407554	missense	possibly damaging	0.50
IGL03064:Adgb	APN	10	10400572	missense	probably benign	0.02
R0080:Adgb	UTSW	10	10377839	splice site	probably benign
R0084:Adgb	UTSW	10	10396344	missense	possibly damaging	0.74
R0112:Adgb	UTSW	10	10407158	splice site	probably benign
R0348:Adgb	UTSW	10	10357879	missense	probably benign
R0415:Adgb	UTSW	10	10431067	splice site	probably null
R0633:Adgb	UTSW	10	10391729	missense	probably benign	0.36
R1052:Adgb	UTSW	10	10442613	missense	probably benign	0.29
R1248:Adgb	UTSW	10	10395310	missense	probably damaging	0.98
R1278:Adgb	UTSW	10	10382828	missense	probably damaging	1.00
R1568:Adgb	UTSW	10	10442665	nonsense	probably null
R1647:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1648:Adgb	UTSW	10	10395371	missense	probably damaging	1.00
R1663:Adgb	UTSW	10	10339675	missense	possibly damaging	0.86
R1688:Adgb	UTSW	10	10350317	nonsense	probably null
R1758:Adgb	UTSW	10	10426605	missense	probably damaging	1.00
R1772:Adgb	UTSW	10	10382721	splice site	probably benign
R1850:Adgb	UTSW	10	10442502	missense	probably damaging	1.00
R1959:Adgb	UTSW	10	10395249	missense	probably benign	0.02
R1980:Adgb	UTSW	10	10433498	missense	probably benign
R2179:Adgb	UTSW	10	10395274	missense	possibly damaging	0.94
R2229:Adgb	UTSW	10	10436051	missense	probably damaging	1.00
R2283:Adgb	UTSW	10	10377891	missense	probably damaging	0.99
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2870:Adgb	UTSW	10	10431281	critical splice donor site	probably null
R2875:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2876:Adgb	UTSW	10	10422719	missense	probably damaging	1.00
R2920:Adgb	UTSW	10	10390243	missense	probably damaging	1.00
R2931:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R3846:Adgb	UTSW	10	10382721	splice site	probably benign
R3877:Adgb	UTSW	10	10442483	critical splice donor site	probably null
R4210:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4211:Adgb	UTSW	10	10407465	missense	probably benign	0.06
R4333:Adgb	UTSW	10	10442502	missense	possibly damaging	0.84
R4448:Adgb	UTSW	10	10390825	missense	probably benign	0.32
R4470:Adgb	UTSW	10	10398951	missense	probably benign	0.02
R4624:Adgb	UTSW	10	10403004	missense	probably benign	0.00
R4656:Adgb	UTSW	10	10405306	missense	probably damaging	0.99
R4676:Adgb	UTSW	10	10426710	missense	probably damaging	1.00
R4792:Adgb	UTSW	10	10398903	missense	probably damaging	0.96
R4795:Adgb	UTSW	10	10357872	missense	probably benign	0.01
R4858:Adgb	UTSW	10	10349577	missense	probably damaging	1.00
R4985:Adgb	UTSW	10	10400632	missense	possibly damaging	0.69
R5057:Adgb	UTSW	10	10357978	missense	probably benign	0.11
R5157:Adgb	UTSW	10	10398966	missense	probably damaging	1.00
R5209:Adgb	UTSW	10	10398937	missense	possibly damaging	0.71
R5339:Adgb	UTSW	10	10442606	missense	probably damaging	1.00
R5376:Adgb	UTSW	10	10346563	missense	probably benign	0.09
R5426:Adgb	UTSW	10	10350260	missense	probably benign	0.14
R5516:Adgb	UTSW	10	10431157	missense	probably damaging	1.00
R5554:Adgb	UTSW	10	10340473	missense	probably damaging	0.98
R5678:Adgb	UTSW	10	10431326	missense	possibly damaging	0.83
R5707:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5708:Adgb	UTSW	10	10391757	missense	probably damaging	1.00
R5891:Adgb	UTSW	10	10377847	nonsense	probably null
R5928:Adgb	UTSW	10	10378787	missense	probably damaging	1.00
R6005:Adgb	UTSW	10	10395352	missense	probably damaging	1.00
R6017:Adgb	UTSW	10	10450036	missense	probably damaging	1.00
R6049:Adgb	UTSW	10	10378026	missense	probably damaging	1.00
R6118:Adgb	UTSW	10	10431291	missense	probably damaging	1.00
R6175:Adgb	UTSW	10	10398943	missense	possibly damaging	0.94
R6186:Adgb	UTSW	10	10422758	missense	probably damaging	1.00
R6234:Adgb	UTSW	10	10353080	splice site	probably null
R6383:Adgb	UTSW	10	10450028	missense	probably damaging	1.00
R6522:Adgb	UTSW	10	10377892	nonsense	probably null
R6639:Adgb	UTSW	10	10435956	missense	possibly damaging	0.51
R6697:Adgb	UTSW	10	10406126	nonsense	probably null
R6742:Adgb	UTSW	10	10411849	missense	probably damaging	1.00
R6745:Adgb	UTSW	10	10390197	missense	probably damaging	1.00
R6850:Adgb	UTSW	10	10394574	missense	probably benign	0.39
R7128:Adgb	UTSW	10	10472241	missense	probably benign	0.26
R7326:Adgb	UTSW	10	10400574	missense	possibly damaging	0.80
R7386:Adgb	UTSW	10	10377949	missense	possibly damaging	0.52
R7431:Adgb	UTSW	10	10391955	splice site	probably null
R7569:Adgb	UTSW	10	10431252	missense	probably benign
R7579:Adgb	UTSW	10	10410818	nonsense	probably null
R7582:Adgb	UTSW	10	10390821	missense	probably damaging	1.00
R7615:Adgb	UTSW	10	10436010	missense	probably damaging	0.96
R7692:Adgb	UTSW	10	10411712	critical splice donor site	probably null
R7774:Adgb	UTSW	10	10339660	nonsense	probably null
R7808:Adgb	UTSW	10	10378659	splice site	probably null
R8158:Adgb	UTSW	10	10378734	missense	probably benign	0.22
R8386:Adgb	UTSW	10	10350304	missense	probably damaging	1.00
R8746:Adgb	UTSW	10	10405284	critical splice donor site	probably null
R8785:Adgb	UTSW	10	10357966	missense	probably damaging	1.00
R9089:Adgb	UTSW	10	10442688	missense	probably benign	0.26
R9140:Adgb	UTSW	10	10340519	nonsense	probably null
R9386:Adgb	UTSW	10	10398964	missense	probably benign	0.00
R9777:Adgb	UTSW	10	10407470	missense	possibly damaging	0.74
X0003:Adgb	UTSW	10	10394630	missense	possibly damaging	0.76
Z1176:Adgb	UTSW	10	10378742	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- CCAAAGGAATTTGTTGCTGTTGC -3'
(R):5'- TAGCATGACTGTCAGACATTTCTC -3'

Sequencing Primer
(F):5'- TATGTAGCTCTAAAGTCACACACAG -3'
(R):5'- GAAGAAAGAGTCTGTTTTTCCTCC -3'

Posted On

2015-01-23