Incidental Mutation 'R3722:Pelp1'
ID258978
Institutional Source Beutler Lab
Gene Symbol Pelp1
Ensembl Gene ENSMUSG00000018921
Gene Nameproline, glutamic acid and leucine rich protein 1
SynonymsMNAR, 4930563C04Rik
MMRRC Submission 040713-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R3722 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70392883-70410031 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70398200 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 240 (Y240C)
Ref Sequence ENSEMBL: ENSMUSP00000019065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019065] [ENSMUST00000135148]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019065
AA Change: Y240C

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000019065
Gene: ENSMUSG00000018921
AA Change: Y240C

DomainStartEndE-ValueType
low complexity region 2 45 N/A INTRINSIC
Pfam:RIX1 63 232 7.5e-30 PFAM
low complexity region 264 278 N/A INTRINSIC
low complexity region 359 386 N/A INTRINSIC
Pfam:NUC202 424 490 8.6e-30 PFAM
Pfam:NUC202 570 644 6e-19 PFAM
low complexity region 748 758 N/A INTRINSIC
low complexity region 797 830 N/A INTRINSIC
low complexity region 834 863 N/A INTRINSIC
low complexity region 869 877 N/A INTRINSIC
SCOP:d1sig__ 892 958 9e-6 SMART
low complexity region 974 989 N/A INTRINSIC
low complexity region 993 1021 N/A INTRINSIC
low complexity region 1070 1090 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135148
SMART Domains Protein: ENSMUSP00000134014
Gene: ENSMUSG00000018921

DomainStartEndE-ValueType
low complexity region 2 45 N/A INTRINSIC
Pfam:RIX1 63 163 2.3e-9 PFAM
Meta Mutation Damage Score 0.4085 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor which coactivates transcription of estrogen receptor responsive genes and corepresses genes activated by other hormone receptors or sequence-specific transcription factors. Expression of this gene is regulated by both members of the estrogen receptor family. This gene may be involved in the progression of several types of cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,340,510 S1485T probably benign Het
Akap9 A G 5: 4,070,351 Y3589C probably damaging Het
Alkbh8 T C 9: 3,385,153 Y482H probably damaging Het
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Arhgap21 T C 2: 20,850,291 E1420G probably damaging Het
Asic3 A T 5: 24,416,999 Y419F probably benign Het
Atg7 A G 6: 114,695,663 Y279C probably damaging Het
Braf G A 6: 39,623,676 P616L probably damaging Het
Btnl2 T C 17: 34,358,135 M88T possibly damaging Het
C1rb T A 6: 124,580,661 Y586N probably damaging Het
Cacna1s T C 1: 136,069,042 F127S possibly damaging Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cox8b T A 7: 140,899,005 K66* probably null Het
Diras2 T A 13: 52,508,023 I83F probably damaging Het
Dlg2 T A 7: 91,711,800 probably null Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Dolpp1 T C 2: 30,397,488 L204P probably damaging Het
Fam170a C T 18: 50,282,204 P306S probably benign Het
Fam205a1 T C 4: 42,851,472 E228G probably benign Het
Fbxl12 A T 9: 20,638,972 probably null Het
Fndc3a T A 14: 72,540,208 I1186F probably benign Het
Gm12886 T A 4: 121,417,470 D71V probably damaging Het
Hist1h3g T C 13: 23,535,552 V36A possibly damaging Het
Ica1 A G 6: 8,659,021 probably benign Het
Ighv8-11 A G 12: 115,567,151 I119T possibly damaging Het
Ism1 A T 2: 139,732,011 R94* probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kcnk15 T C 2: 163,858,294 L132P probably damaging Het
Lrmda T A 14: 22,027,331 probably benign Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mkl2 C T 16: 13,385,693 A201V probably damaging Het
Ncstn G A 1: 172,067,895 T562M possibly damaging Het
Nudt4 A T 10: 95,549,505 probably null Het
Olfr1248 A T 2: 89,618,159 I11N possibly damaging Het
Olfr958 A C 9: 39,550,122 C250G probably damaging Het
Omp T C 7: 98,145,213 N69S probably benign Het
Pak1 C T 7: 97,854,497 P13L probably damaging Het
Pde4d T A 13: 109,951,332 C744* probably null Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Ptprk A G 10: 28,383,623 D353G probably damaging Het
Ptprs A G 17: 56,417,485 F1152S probably damaging Het
Rnf135 G T 11: 80,196,917 A231S probably benign Het
Rpn1 G A 6: 88,090,300 probably null Het
Rreb1 T A 13: 37,947,098 D1409E probably benign Het
Sipa1l2 G A 8: 125,473,584 H668Y probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Slc35d1 T C 4: 103,208,124 K187E possibly damaging Het
Slc44a2 A T 9: 21,342,977 I212F possibly damaging Het
Slc7a1 G A 5: 148,335,533 R445* probably null Het
Snapc4 A G 2: 26,365,428 L1028P probably benign Het
Snrnp40 C T 4: 130,368,275 T152I possibly damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Tex2 C T 11: 106,546,740 W203* probably null Het
Tmcc1 T C 6: 116,133,822 E170G possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Ttll6 A G 11: 96,133,921 N46D probably benign Het
Txk T A 5: 72,707,735 K266* probably null Het
Uggt2 T C 14: 119,041,518 E859G probably damaging Het
Uros A T 7: 133,702,391 M1K probably null Het
Vps13b T A 15: 35,671,382 I1677N probably damaging Het
Zbtb5 A G 4: 44,994,863 probably null Het
Zfp760 A G 17: 21,722,162 Y106C probably damaging Het
Other mutations in Pelp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Pelp1 APN 11 70394812 missense possibly damaging 0.88
IGL00819:Pelp1 APN 11 70394618 missense unknown
IGL01017:Pelp1 APN 11 70396894 missense probably damaging 1.00
IGL01347:Pelp1 APN 11 70395679 missense probably damaging 1.00
IGL01460:Pelp1 APN 11 70393964 missense unknown
IGL02022:Pelp1 APN 11 70406327 splice site probably benign
IGL02188:Pelp1 APN 11 70409892 missense unknown
ANU74:Pelp1 UTSW 11 70395087 missense probably damaging 0.97
F5770:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
R0056:Pelp1 UTSW 11 70393832 missense unknown
R0201:Pelp1 UTSW 11 70395704 missense possibly damaging 0.84
R0637:Pelp1 UTSW 11 70395704 missense possibly damaging 0.84
R0879:Pelp1 UTSW 11 70395297 splice site probably benign
R1073:Pelp1 UTSW 11 70396590 missense probably damaging 1.00
R1858:Pelp1 UTSW 11 70394742 missense probably damaging 0.99
R1937:Pelp1 UTSW 11 70393715 intron probably null
R1958:Pelp1 UTSW 11 70398521 missense probably damaging 0.99
R3613:Pelp1 UTSW 11 70395435 missense probably benign 0.01
R4176:Pelp1 UTSW 11 70396867 missense probably damaging 1.00
R5137:Pelp1 UTSW 11 70395099 missense probably damaging 0.98
R5253:Pelp1 UTSW 11 70401661 missense probably damaging 1.00
R5616:Pelp1 UTSW 11 70394862 missense possibly damaging 0.73
R5911:Pelp1 UTSW 11 70396914 missense probably damaging 0.99
R5938:Pelp1 UTSW 11 70394867 missense probably damaging 0.98
R6461:Pelp1 UTSW 11 70396306 missense probably damaging 1.00
R7387:Pelp1 UTSW 11 70396599 missense probably damaging 0.99
R7625:Pelp1 UTSW 11 70395434 missense probably benign 0.03
R7694:Pelp1 UTSW 11 70394759 missense probably damaging 0.99
R7873:Pelp1 UTSW 11 70394726 missense probably damaging 1.00
R7956:Pelp1 UTSW 11 70394726 missense probably damaging 1.00
V7580:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
V7581:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
V7582:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
V7583:Pelp1 UTSW 11 70398150 missense probably damaging 0.99
Z1088:Pelp1 UTSW 11 70396890 missense probably damaging 1.00
Z1177:Pelp1 UTSW 11 70397094 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTCTCATCCATGTCACCCAGAAAC -3'
(R):5'- ATTGCACAGCATTTGGACCC -3'

Sequencing Primer
(F):5'- GTGGACCACACTTGTTCCC -3'
(R):5'- GCACAGCATTTGGACCCTCTTTTC -3'
Posted On2015-01-23