Incidental Mutation 'R3722:Appl1'
ID258987
Institutional Source Beutler Lab
Gene Symbol Appl1
Ensembl Gene ENSMUSG00000040760
Gene Nameadaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms7330406P05Rik, 2900057D21Rik
MMRRC Submission 040713-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock #R3722 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location26918988-26971232 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26927844 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 575 (T575M)
Ref Sequence ENSEMBL: ENSMUSP00000042875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036570]
Predicted Effect probably damaging
Transcript: ENSMUST00000036570
AA Change: T575M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000042875
Gene: ENSMUSG00000040760
AA Change: T575M

DomainStartEndE-ValueType
Pfam:BAR_3 7 249 2.6e-66 PFAM
PH 278 377 1.4e-3 SMART
low complexity region 425 434 N/A INTRINSIC
Pfam:PID 501 632 6.6e-12 PFAM
low complexity region 645 660 N/A INTRINSIC
low complexity region 679 700 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223843
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has been shown to be involved in the regulation of cell proliferation, and in the crosstalk between the adiponectin signalling and insulin signalling pathways. The encoded protein binds many other proteins, including RAB5A, DCC, AKT2, PIK3CA, adiponectin receptors, and proteins of the NuRD/MeCP1 complex. This protein is found associated with endosomal membranes, but can be released by EGF and translocated to the nucleus. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased insulin-induced relaxation and increased insulin-induced ET-1-dependent vasoconstriction when fed a high fat diet. Homozygotes for a second null allele show increased hematocrit and T cell proliferation, and decreased fibroblast cell migration. Homozygotes for a third null allele show hyperactivity, increased body core temperature, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,340,510 S1485T probably benign Het
Akap9 A G 5: 4,070,351 Y3589C probably damaging Het
Alkbh8 T C 9: 3,385,153 Y482H probably damaging Het
Arhgap21 T C 2: 20,850,291 E1420G probably damaging Het
Asic3 A T 5: 24,416,999 Y419F probably benign Het
Atg7 A G 6: 114,695,663 Y279C probably damaging Het
Braf G A 6: 39,623,676 P616L probably damaging Het
Btnl2 T C 17: 34,358,135 M88T possibly damaging Het
C1rb T A 6: 124,580,661 Y586N probably damaging Het
Cacna1s T C 1: 136,069,042 F127S possibly damaging Het
Cd47 A G 16: 49,867,842 I42V probably benign Het
Cox8b T A 7: 140,899,005 K66* probably null Het
Diras2 T A 13: 52,508,023 I83F probably damaging Het
Dlg2 T A 7: 91,711,800 probably null Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Dolpp1 T C 2: 30,397,488 L204P probably damaging Het
Fam170a C T 18: 50,282,204 P306S probably benign Het
Fam205a1 T C 4: 42,851,472 E228G probably benign Het
Fbxl12 A T 9: 20,638,972 probably null Het
Fndc3a T A 14: 72,540,208 I1186F probably benign Het
Gm12886 T A 4: 121,417,470 D71V probably damaging Het
Hist1h3g T C 13: 23,535,552 V36A possibly damaging Het
Ica1 A G 6: 8,659,021 probably benign Het
Ighv8-11 A G 12: 115,567,151 I119T possibly damaging Het
Ism1 A T 2: 139,732,011 R94* probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kcnk15 T C 2: 163,858,294 L132P probably damaging Het
Lrmda T A 14: 22,027,331 probably benign Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mkl2 C T 16: 13,385,693 A201V probably damaging Het
Ncstn G A 1: 172,067,895 T562M possibly damaging Het
Nudt4 A T 10: 95,549,505 probably null Het
Olfr1248 A T 2: 89,618,159 I11N possibly damaging Het
Olfr958 A C 9: 39,550,122 C250G probably damaging Het
Omp T C 7: 98,145,213 N69S probably benign Het
Pak1 C T 7: 97,854,497 P13L probably damaging Het
Pde4d T A 13: 109,951,332 C744* probably null Het
Pelp1 T C 11: 70,398,200 Y240C possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Ptprk A G 10: 28,383,623 D353G probably damaging Het
Ptprs A G 17: 56,417,485 F1152S probably damaging Het
Rnf135 G T 11: 80,196,917 A231S probably benign Het
Rpn1 G A 6: 88,090,300 probably null Het
Rreb1 T A 13: 37,947,098 D1409E probably benign Het
Sipa1l2 G A 8: 125,473,584 H668Y probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Slc35d1 T C 4: 103,208,124 K187E possibly damaging Het
Slc44a2 A T 9: 21,342,977 I212F possibly damaging Het
Slc7a1 G A 5: 148,335,533 R445* probably null Het
Snapc4 A G 2: 26,365,428 L1028P probably benign Het
Snrnp40 C T 4: 130,368,275 T152I possibly damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Tex2 C T 11: 106,546,740 W203* probably null Het
Tmcc1 T C 6: 116,133,822 E170G possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Ttll6 A G 11: 96,133,921 N46D probably benign Het
Txk T A 5: 72,707,735 K266* probably null Het
Uggt2 T C 14: 119,041,518 E859G probably damaging Het
Uros A T 7: 133,702,391 M1K probably null Het
Vps13b T A 15: 35,671,382 I1677N probably damaging Het
Zbtb5 A G 4: 44,994,863 probably null Het
Zfp760 A G 17: 21,722,162 Y106C probably damaging Het
Other mutations in Appl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Appl1 APN 14 26949476 missense possibly damaging 0.89
IGL01615:Appl1 APN 14 26959470 splice site probably benign
IGL01633:Appl1 APN 14 26962838 missense probably damaging 0.99
IGL01945:Appl1 APN 14 26928655 missense possibly damaging 0.80
IGL02210:Appl1 APN 14 26925952 splice site probably benign
IGL02650:Appl1 APN 14 26950708 missense possibly damaging 0.76
IGL02674:Appl1 APN 14 26949461 missense possibly damaging 0.86
IGL02803:Appl1 APN 14 26951516 missense possibly damaging 0.93
R0129:Appl1 UTSW 14 26928643 missense probably damaging 1.00
R0183:Appl1 UTSW 14 26962854 missense probably damaging 1.00
R0323:Appl1 UTSW 14 26942738 missense possibly damaging 0.91
R0411:Appl1 UTSW 14 26940256 missense probably benign
R1213:Appl1 UTSW 14 26943993 missense probably benign 0.27
R1277:Appl1 UTSW 14 26927856 missense possibly damaging 0.87
R1668:Appl1 UTSW 14 26923854 missense probably damaging 1.00
R1856:Appl1 UTSW 14 26927749 missense probably damaging 1.00
R1889:Appl1 UTSW 14 26925513 splice site probably benign
R2145:Appl1 UTSW 14 26949619 missense possibly damaging 0.66
R3720:Appl1 UTSW 14 26927844 missense probably damaging 1.00
R3917:Appl1 UTSW 14 26928604 missense probably damaging 1.00
R4700:Appl1 UTSW 14 26925971 missense probably benign 0.00
R5139:Appl1 UTSW 14 26947155 missense probably benign 0.04
R5485:Appl1 UTSW 14 26962866 missense probably damaging 1.00
R5536:Appl1 UTSW 14 26923780 nonsense probably null
R5795:Appl1 UTSW 14 26942816 missense probably benign 0.01
R7044:Appl1 UTSW 14 26928677 missense possibly damaging 0.90
R7318:Appl1 UTSW 14 26963660 missense probably benign 0.01
R7447:Appl1 UTSW 14 26959452 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCGTAATCGGAGAGCTTTTCC -3'
(R):5'- CCCTAGAGAGTTTATGCACCAAAGG -3'

Sequencing Primer
(F):5'- GGAGAGCTTTTCCCAGAAATTTAAGG -3'
(R):5'- GTTTATGCACCAAAGGAATTAGCAG -3'
Posted On2015-01-23