Incidental Mutation 'R3722:Cd47'
ID258996
Institutional Source Beutler Lab
Gene Symbol Cd47
Ensembl Gene ENSMUSG00000055447
Gene NameCD47 antigen (Rh-related antigen, integrin-associated signal transducer)
SynonymsB430305P08Rik, 9130415E20Rik, integrin-associated protein, Itgp, IAP
MMRRC Submission 040713-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3722 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location49800533-49915010 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49867842 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 42 (I42V)
Ref Sequence ENSEMBL: ENSMUSP00000155178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084838] [ENSMUST00000114496] [ENSMUST00000229101] [ENSMUST00000229104] [ENSMUST00000229206] [ENSMUST00000229640] [ENSMUST00000230281] [ENSMUST00000230641] [ENSMUST00000230836]
Predicted Effect probably benign
Transcript: ENSMUST00000084838
AA Change: I42V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099853
Gene: ENSMUSG00000055447
AA Change: I42V

DomainStartEndE-ValueType
Pfam:V-set_CD47 8 137 2.2e-46 PFAM
Pfam:CD47 163 317 4.7e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114496
SMART Domains Protein: ENSMUSP00000110140
Gene: ENSMUSG00000055447

DomainStartEndE-ValueType
Pfam:V-set_CD47 1 41 1.8e-15 PFAM
Pfam:CD47 42 199 6.8e-59 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229101
Predicted Effect probably benign
Transcript: ENSMUST00000229104
Predicted Effect probably benign
Transcript: ENSMUST00000229206
AA Change: I42V

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000229640
Predicted Effect probably benign
Transcript: ENSMUST00000230281
Predicted Effect probably benign
Transcript: ENSMUST00000230641
AA Change: I42V

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000230836
AA Change: I42V

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231187
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which is involved in the increase in intracellular calcium concentration that occurs upon cell adhesion to extracellular matrix. The encoded protein is also a receptor for the C-terminal cell binding domain of thrombospondin, and it may play a role in membrane transport and signal transduction. This gene has broad tissue distribution, and is reduced in expression on Rh erythrocytes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous mutation of this gene results in a reduced CD3+ fraction of peripheral lymphocytes and inability to clear infection by E.coli. Mutant animals are otherwise normal in appearance, survival, and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A T 10: 10,340,510 S1485T probably benign Het
Akap9 A G 5: 4,070,351 Y3589C probably damaging Het
Alkbh8 T C 9: 3,385,153 Y482H probably damaging Het
Appl1 G A 14: 26,927,844 T575M probably damaging Het
Arhgap21 T C 2: 20,850,291 E1420G probably damaging Het
Asic3 A T 5: 24,416,999 Y419F probably benign Het
Atg7 A G 6: 114,695,663 Y279C probably damaging Het
Braf G A 6: 39,623,676 P616L probably damaging Het
Btnl2 T C 17: 34,358,135 M88T possibly damaging Het
C1rb T A 6: 124,580,661 Y586N probably damaging Het
Cacna1s T C 1: 136,069,042 F127S possibly damaging Het
Cox8b T A 7: 140,899,005 K66* probably null Het
Diras2 T A 13: 52,508,023 I83F probably damaging Het
Dlg2 T A 7: 91,711,800 probably null Het
Dnah8 G A 17: 30,854,898 R4514H probably damaging Het
Dnaic1 G A 4: 41,602,615 R113H probably damaging Het
Dolpp1 T C 2: 30,397,488 L204P probably damaging Het
Fam170a C T 18: 50,282,204 P306S probably benign Het
Fam205a1 T C 4: 42,851,472 E228G probably benign Het
Fbxl12 A T 9: 20,638,972 probably null Het
Fndc3a T A 14: 72,540,208 I1186F probably benign Het
Gm12886 T A 4: 121,417,470 D71V probably damaging Het
Hist1h3g T C 13: 23,535,552 V36A possibly damaging Het
Ica1 A G 6: 8,659,021 probably benign Het
Ighv8-11 A G 12: 115,567,151 I119T possibly damaging Het
Ism1 A T 2: 139,732,011 R94* probably null Het
Kbtbd11 T A 8: 15,029,118 C572* probably null Het
Kcnk15 T C 2: 163,858,294 L132P probably damaging Het
Lrmda T A 14: 22,027,331 probably benign Het
Mei1 A G 15: 82,103,204 H399R possibly damaging Het
Mkl2 C T 16: 13,385,693 A201V probably damaging Het
Ncstn G A 1: 172,067,895 T562M possibly damaging Het
Nudt4 A T 10: 95,549,505 probably null Het
Olfr1248 A T 2: 89,618,159 I11N possibly damaging Het
Olfr958 A C 9: 39,550,122 C250G probably damaging Het
Omp T C 7: 98,145,213 N69S probably benign Het
Pak1 C T 7: 97,854,497 P13L probably damaging Het
Pde4d T A 13: 109,951,332 C744* probably null Het
Pelp1 T C 11: 70,398,200 Y240C possibly damaging Het
Pou2f1 G C 1: 165,894,969 P349R probably damaging Het
Ptprk A G 10: 28,383,623 D353G probably damaging Het
Ptprs A G 17: 56,417,485 F1152S probably damaging Het
Rnf135 G T 11: 80,196,917 A231S probably benign Het
Rpn1 G A 6: 88,090,300 probably null Het
Rreb1 T A 13: 37,947,098 D1409E probably benign Het
Sipa1l2 G A 8: 125,473,584 H668Y probably damaging Het
Slc35a5 A T 16: 45,147,322 I138N probably damaging Het
Slc35d1 T C 4: 103,208,124 K187E possibly damaging Het
Slc44a2 A T 9: 21,342,977 I212F possibly damaging Het
Slc7a1 G A 5: 148,335,533 R445* probably null Het
Snapc4 A G 2: 26,365,428 L1028P probably benign Het
Snrnp40 C T 4: 130,368,275 T152I possibly damaging Het
Spink4 T A 4: 40,929,136 C54S probably damaging Het
Tex2 C T 11: 106,546,740 W203* probably null Het
Tmcc1 T C 6: 116,133,822 E170G possibly damaging Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Ttll6 A G 11: 96,133,921 N46D probably benign Het
Txk T A 5: 72,707,735 K266* probably null Het
Uggt2 T C 14: 119,041,518 E859G probably damaging Het
Uros A T 7: 133,702,391 M1K probably null Het
Vps13b T A 15: 35,671,382 I1677N probably damaging Het
Zbtb5 A G 4: 44,994,863 probably null Het
Zfp760 A G 17: 21,722,162 Y106C probably damaging Het
Other mutations in Cd47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03253:Cd47 APN 16 49894198 missense probably benign 0.11
R0675:Cd47 UTSW 16 49906799 missense possibly damaging 0.61
R1374:Cd47 UTSW 16 49894180 missense probably damaging 1.00
R1651:Cd47 UTSW 16 49894228 missense possibly damaging 0.93
R1712:Cd47 UTSW 16 49894180 missense probably damaging 1.00
R1803:Cd47 UTSW 16 49867806 missense possibly damaging 0.87
R3720:Cd47 UTSW 16 49867842 missense probably benign 0.09
R4525:Cd47 UTSW 16 49867792 missense probably benign 0.15
R5366:Cd47 UTSW 16 49896373 missense probably damaging 1.00
R6878:Cd47 UTSW 16 49910869 missense possibly damaging 0.82
R7219:Cd47 UTSW 16 49908077 missense possibly damaging 0.50
R7470:Cd47 UTSW 16 49884222 missense
R8068:Cd47 UTSW 16 49895416 missense
Predicted Primers PCR Primer
(F):5'- ACCTTGTTCCTGTACTACAAGC -3'
(R):5'- AGTTTCCCACCATGGCATC -3'

Sequencing Primer
(F):5'- CTACAAGCATAAATGAACAGTTGCAG -3'
(R):5'- CGCGCTTATCCATTTTCAAAGAGG -3'
Posted On2015-01-23