Incidental Mutation 'R3236:Zgrf1'
ID259019
Institutional Source Beutler Lab
Gene Symbol Zgrf1
Ensembl Gene ENSMUSG00000051278
Gene Namezinc finger, GRF-type containing 1
Synonyms4930422G04Rik
MMRRC Submission 040618-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R3236 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location127553489-127618023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127613375 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1597 (D1597G)
Ref Sequence ENSEMBL: ENSMUSP00000143761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043108] [ENSMUST00000196141] [ENSMUST00000196341] [ENSMUST00000199888] [ENSMUST00000200490]
Predicted Effect probably damaging
Transcript: ENSMUST00000043108
AA Change: D1597G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044432
Gene: ENSMUSG00000051278
AA Change: D1597G

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196141
AA Change: D1597G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143761
Gene: ENSMUSG00000051278
AA Change: D1597G

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.7e-23 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
low complexity region 896 906 N/A INTRINSIC
Pfam:zf-GRF 1109 1153 1.5e-17 PFAM
low complexity region 1316 1328 N/A INTRINSIC
Pfam:AAA_11 1501 1608 1.6e-21 PFAM
Pfam:AAA_12 1616 1802 1.3e-51 PFAM
coiled coil region 1833 1861 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196341
SMART Domains Protein: ENSMUSP00000143570
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Pfam:zf-GRF 225 269 6.7e-15 PFAM
low complexity region 432 444 N/A INTRINSIC
Pfam:AAA_11 491 659 7.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199888
SMART Domains Protein: ENSMUSP00000142693
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 82 3.5e-22 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200490
SMART Domains Protein: ENSMUSP00000143585
Gene: ENSMUSG00000051278

DomainStartEndE-ValueType
Pfam:DUF2439 3 81 3.4e-20 PFAM
low complexity region 92 105 N/A INTRINSIC
low complexity region 628 639 N/A INTRINSIC
Meta Mutation Damage Score 0.8662 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
5730455P16Rik G A 11: 80,368,170 L255F probably damaging Het
9130011E15Rik A T 19: 45,975,283 probably benign Het
Aff2 T A X: 69,863,937 V1175E possibly damaging Het
Agbl3 A G 6: 34,823,087 probably null Het
Atm T A 9: 53,479,748 D1842V probably benign Het
Bcar3 C A 3: 122,524,996 Q678K probably benign Het
Ccdc88a A G 11: 29,447,995 T243A possibly damaging Het
Col5a3 G T 9: 20,807,653 N268K unknown Het
Col6a1 G A 10: 76,711,320 T737M unknown Het
Cyp3a25 T C 5: 146,003,128 probably benign Het
Dnah17 T C 11: 118,094,854 T1466A probably benign Het
Dnah9 G A 11: 65,954,989 T3023I probably benign Het
Ecm1 G T 3: 95,734,846 Q476K possibly damaging Het
Eml6 A G 11: 29,831,097 probably null Het
Fbxo18 T C 2: 11,769,826 D36G probably damaging Het
Fyb A C 15: 6,630,116 D434A probably damaging Het
Gm5478 A G 15: 101,644,303 Y398H probably damaging Het
H2-Q6 C A 17: 35,425,700 T155K probably damaging Het
Hk1 T C 10: 62,296,019 probably null Het
Kdm6b A G 11: 69,406,366 Y387H probably damaging Het
Lipn A G 19: 34,068,738 N37S probably benign Het
Lrig3 G A 10: 125,997,187 C310Y probably damaging Het
Map6 T A 7: 99,336,824 V645E probably damaging Het
Memo1 A T 17: 74,202,352 I224K probably damaging Het
Morc2a T C 11: 3,683,612 I602T probably benign Het
N4bp3 A T 11: 51,645,934 F104Y probably damaging Het
Ndrg3 T A 2: 156,944,037 I161F probably damaging Het
Notch3 T C 17: 32,158,461 R214G probably damaging Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr116 T C 17: 37,624,236 E133G possibly damaging Het
Olfr1178 T C 2: 88,391,406 I53T probably benign Het
Pdgfra T C 5: 75,167,936 V243A probably damaging Het
Piwil4 A G 9: 14,700,248 probably benign Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pon2 A T 6: 5,266,986 N252K possibly damaging Het
Ptf1a T C 2: 19,445,907 F16S probably damaging Het
Rasgrp1 A G 2: 117,291,812 Y366H probably benign Het
Rbfox1 G A 16: 7,408,028 V353I possibly damaging Het
Rrh T C 3: 129,811,711 Y110C probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scaf4 T A 16: 90,260,217 D82V unknown Het
Serhl C A 15: 83,104,403 P177Q probably damaging Het
Setdb1 A G 3: 95,338,754 V619A probably damaging Het
Sf3b3 A G 8: 110,812,020 S1123P probably damaging Het
Slc1a3 T C 15: 8,639,123 I453V probably damaging Het
Slf2 A G 19: 44,942,334 I617V probably benign Het
Snrnp200 T A 2: 127,221,882 D660E probably damaging Het
Spata22 T A 11: 73,345,887 F340I probably damaging Het
Speer4e T A 5: 14,934,925 E206D possibly damaging Het
Stard6 T A 18: 70,500,486 M188K probably damaging Het
Stat6 G A 10: 127,652,222 V282I possibly damaging Het
Supt20 T C 3: 54,709,080 S253P possibly damaging Het
Szt2 A C 4: 118,383,034 probably null Het
Thsd4 C A 9: 60,394,387 K208N probably benign Het
Thsd7b C T 1: 130,218,118 Q1588* probably null Het
Tmem167 C T 13: 90,104,380 R52C probably benign Het
Ttn T C 2: 76,899,409 probably benign Het
Usp39 G A 6: 72,338,389 probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vmn2r24 C T 6: 123,779,025 Q19* probably null Het
Vps13b G A 15: 35,910,304 E3405K probably benign Het
Other mutations in Zgrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Zgrf1 APN 3 127588141 splice site probably benign
IGL01153:Zgrf1 APN 3 127602406 missense probably damaging 1.00
IGL01330:Zgrf1 APN 3 127584007 missense probably damaging 1.00
IGL01501:Zgrf1 APN 3 127602562 splice site probably null
IGL01827:Zgrf1 APN 3 127616281 missense probably benign 0.06
IGL02600:Zgrf1 APN 3 127600974 splice site probably benign
IGL03122:Zgrf1 APN 3 127588133 missense possibly damaging 0.91
IGL03365:Zgrf1 APN 3 127598774 missense possibly damaging 0.48
R0015:Zgrf1 UTSW 3 127555397 splice site probably benign
R0243:Zgrf1 UTSW 3 127615446 missense probably damaging 0.99
R0468:Zgrf1 UTSW 3 127562041 missense possibly damaging 0.72
R0497:Zgrf1 UTSW 3 127584650 splice site probably benign
R0505:Zgrf1 UTSW 3 127573238 missense probably benign 0.30
R0511:Zgrf1 UTSW 3 127584660 missense possibly damaging 0.93
R0539:Zgrf1 UTSW 3 127615192 missense probably damaging 1.00
R0617:Zgrf1 UTSW 3 127588038 missense probably benign 0.39
R1298:Zgrf1 UTSW 3 127583889 missense possibly damaging 0.95
R1353:Zgrf1 UTSW 3 127611803 missense probably damaging 1.00
R1593:Zgrf1 UTSW 3 127561026 missense possibly damaging 0.86
R1846:Zgrf1 UTSW 3 127615463 missense probably damaging 1.00
R1912:Zgrf1 UTSW 3 127563137 missense probably benign
R2062:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2064:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2065:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2066:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2067:Zgrf1 UTSW 3 127613350 missense probably damaging 1.00
R2256:Zgrf1 UTSW 3 127561997 missense probably benign 0.18
R2321:Zgrf1 UTSW 3 127562407 nonsense probably null
R2381:Zgrf1 UTSW 3 127556214 missense probably benign 0.02
R2913:Zgrf1 UTSW 3 127598707 missense possibly damaging 0.65
R3147:Zgrf1 UTSW 3 127584148 missense possibly damaging 0.84
R3237:Zgrf1 UTSW 3 127613375 missense probably damaging 1.00
R4433:Zgrf1 UTSW 3 127562078 missense probably benign
R4441:Zgrf1 UTSW 3 127586137 missense possibly damaging 0.45
R4457:Zgrf1 UTSW 3 127595929 missense probably damaging 1.00
R4498:Zgrf1 UTSW 3 127586100 nonsense probably null
R4598:Zgrf1 UTSW 3 127601030 missense probably benign 0.14
R4701:Zgrf1 UTSW 3 127598704 missense probably benign 0.03
R4898:Zgrf1 UTSW 3 127602436 missense probably damaging 1.00
R4944:Zgrf1 UTSW 3 127561868 nonsense probably null
R5256:Zgrf1 UTSW 3 127602445 missense probably damaging 1.00
R5294:Zgrf1 UTSW 3 127600980 missense probably benign 0.14
R5358:Zgrf1 UTSW 3 127567703 critical splice donor site probably null
R5359:Zgrf1 UTSW 3 127601165 missense possibly damaging 0.95
R5447:Zgrf1 UTSW 3 127563119 missense possibly damaging 0.73
R5569:Zgrf1 UTSW 3 127561025 missense probably benign 0.33
R5887:Zgrf1 UTSW 3 127584765 missense probably damaging 1.00
R5914:Zgrf1 UTSW 3 127561023 missense probably damaging 0.99
R5925:Zgrf1 UTSW 3 127573204 missense possibly damaging 0.84
R5936:Zgrf1 UTSW 3 127562253 missense possibly damaging 0.72
R6087:Zgrf1 UTSW 3 127615486 missense probably damaging 1.00
R6089:Zgrf1 UTSW 3 127595993 missense probably damaging 1.00
R6181:Zgrf1 UTSW 3 127587941 missense probably damaging 1.00
R6277:Zgrf1 UTSW 3 127598812 missense possibly damaging 0.81
R6441:Zgrf1 UTSW 3 127588034 missense possibly damaging 0.93
R6659:Zgrf1 UTSW 3 127616506 missense probably damaging 0.99
R6857:Zgrf1 UTSW 3 127581447 missense probably damaging 0.99
R6932:Zgrf1 UTSW 3 127559632 critical splice donor site probably null
R7008:Zgrf1 UTSW 3 127561772 missense probably benign 0.18
R7175:Zgrf1 UTSW 3 127563590 missense probably damaging 1.00
R7264:Zgrf1 UTSW 3 127563569 missense probably benign 0.00
R7272:Zgrf1 UTSW 3 127598760 missense probably damaging 0.99
R7298:Zgrf1 UTSW 3 127583650 nonsense probably null
R7412:Zgrf1 UTSW 3 127563071 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TAGTTAGCACCACTGAGCCC -3'
(R):5'- CACCTTAAGTTGAACACTCATGGATAG -3'

Sequencing Primer
(F):5'- CCGCTAGGTCTGAGGACTTGTC -3'
(R):5'- GAGAAACAGCTCCATTTTTAAAGGC -3'
Posted On2015-01-23